ID: 1084013224

View in Genome Browser
Species Human (GRCh38)
Location 11:66364136-66364158
Sequence GGCCGTCCCTCCATTGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084013222_1084013224 -9 Left 1084013222 11:66364122-66364144 CCAGAAGCAGGATGGGCCGTCCC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1084013224 11:66364136-66364158 GGCCGTCCCTCCATTGCAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 81
1084013217_1084013224 17 Left 1084013217 11:66364096-66364118 CCTGCAGACAGCTAGGGTTGGGC 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1084013224 11:66364136-66364158 GGCCGTCCCTCCATTGCAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 81
1084013212_1084013224 26 Left 1084013212 11:66364087-66364109 CCAGCAAGGCCTGCAGACAGCTA 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1084013224 11:66364136-66364158 GGCCGTCCCTCCATTGCAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084013224 Original CRISPR GGCCGTCCCTCCATTGCAGG CGG Intronic