ID: 1084014242

View in Genome Browser
Species Human (GRCh38)
Location 11:66369281-66369303
Sequence CAGTAGGGCTGGGGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1023
Summary {0: 1, 1: 0, 2: 8, 3: 103, 4: 911}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084014224_1084014242 19 Left 1084014224 11:66369239-66369261 CCAGAGGGGGCTGGGGAAGGAGG 0: 1
1: 1
2: 7
3: 165
4: 1253
Right 1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG 0: 1
1: 0
2: 8
3: 103
4: 911
1084014222_1084014242 24 Left 1084014222 11:66369234-66369256 CCAGGCCAGAGGGGGCTGGGGAA 0: 1
1: 0
2: 2
3: 49
4: 516
Right 1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG 0: 1
1: 0
2: 8
3: 103
4: 911
1084014221_1084014242 25 Left 1084014221 11:66369233-66369255 CCCAGGCCAGAGGGGGCTGGGGA 0: 1
1: 1
2: 5
3: 65
4: 596
Right 1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG 0: 1
1: 0
2: 8
3: 103
4: 911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084014242 Original CRISPR CAGTAGGGCTGGGGGGCAGG GGG Intronic
900101633 1:964536-964558 CAGTGGGGCTGCGGGGAGGGGGG + Intronic
900151849 1:1182338-1182360 CTGCAGGGCAGGGAGGCAGGAGG - Intronic
900183816 1:1324032-1324054 CTGGAGCGCTGGGGGGCTGGGGG + Intronic
900183854 1:1324128-1324150 CTGAGGGGCTGGGGGGCTGGGGG + Intronic
900436646 1:2634198-2634220 CACCAGGGCTGTCGGGCAGGTGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900830737 1:4963555-4963577 CAGTAAGACTGGGGAGCAGGGGG - Intergenic
901109986 1:6786010-6786032 CAGTGGGGCGCGGGGCCAGGAGG - Intronic
901216574 1:7558572-7558594 CACTAGGGCTGATGGGCAGTGGG + Intronic
901401126 1:9015677-9015699 CAGCAGGGGTGGGAGGCAGACGG - Intronic
901489336 1:9588830-9588852 CAGGCGGGCAGGCGGGCAGGAGG - Intergenic
901489339 1:9588838-9588860 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
901656289 1:10771689-10771711 CAGTTGGGCTGGTGAGGAGGAGG - Intronic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902513319 1:16977562-16977584 CAGGAGGGCTGGTGGGCTGGAGG - Intronic
902521763 1:17022043-17022065 GAGAAGTGCTGGGAGGCAGGCGG + Intronic
902609743 1:17589958-17589980 CAGGATGGCAGAGGGGCAGGGGG + Intronic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903192795 1:21666290-21666312 CAGCAAGGCTGGGGGCCAGCTGG - Intronic
903218434 1:21855547-21855569 CAGCAGCGCTGGGCAGCAGGTGG - Exonic
903249675 1:22043589-22043611 CAGTAGGGTTGGGGGGCTCCTGG + Intergenic
903319847 1:22536158-22536180 GAGTAGGGCTGTGGGGCAGGTGG + Intergenic
903385766 1:22925162-22925184 GTGTAGGGCTGGGGGGCTGAGGG - Intergenic
903759094 1:25685350-25685372 CAGCAGAGCTGAGGCGCAGGTGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904462740 1:30689927-30689949 CCCTAGGGGTGGGGGGCAGCGGG - Intergenic
904598208 1:31659787-31659809 CAGTAGGGCTGAGGTTGAGGGGG - Intronic
904991818 1:34599165-34599187 CAGGAGTGGTGGGAGGCAGGTGG - Intergenic
905124765 1:35708545-35708567 GAGTAGGGCTGGGAGGAGGGGGG + Intergenic
905460642 1:38120729-38120751 CAGGAGGGCAGTGGGGCTGGAGG - Intergenic
905524888 1:38629299-38629321 CTGTTGGGGTGGGGGGCTGGGGG - Intergenic
905894727 1:41538112-41538134 CAGTGGGGGTGGGTGTCAGGTGG + Intronic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
906650206 1:47507839-47507861 CAGCGGGGCTGAGGGGCTGGGGG + Intergenic
907114382 1:51956076-51956098 CTGTAAGGCTGGGAGGCAGGAGG + Intronic
907275606 1:53315111-53315133 CAGGAGGGGTGGGGTGCAGAAGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907411835 1:54288577-54288599 CAGCAGGGGTGGGGGGGGGGAGG + Intronic
907441333 1:54480483-54480505 CCATAGGGCTGGGGGGCCGCTGG - Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907469694 1:54665297-54665319 CTGCTGGGCTGGGGGGTAGGGGG - Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
908021316 1:59901385-59901407 CAGTAGGGCTTGGAAGGAGGGGG + Intronic
908277852 1:62494657-62494679 CAGTTGGTGGGGGGGGCAGGAGG + Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
909032178 1:70555261-70555283 CAGTAGGGATGTGGGGCAGAGGG - Intergenic
910245334 1:85132697-85132719 CAGGAGGGCAGGTGGGCAGGAGG - Intronic
910245337 1:85132705-85132727 CAGGAAGGCAGGAGGGCAGGTGG - Intronic
911658675 1:100475549-100475571 CAGCTGGGTTGGGGGGCAGGGGG + Intronic
912455158 1:109792155-109792177 CAGGTGGGCTGGGGGGCTGGGGG + Intergenic
912471209 1:109908199-109908221 CAGTGGGGCTGGGGGGCTTGCGG + Intergenic
912957503 1:114165745-114165767 GAGGAGGGCTCAGGGGCAGGAGG + Intergenic
913191367 1:116416016-116416038 CAGAAGGGTTGGGGGGGGGGAGG + Intergenic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914267714 1:146052323-146052345 TAGGAGGGCTGGGGGGGAGGGGG - Intergenic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
914747814 1:150512420-150512442 GAGTAGGGCTGGGAGGGTGGCGG - Exonic
914767635 1:150653542-150653564 CAGTTGGGCTGGGGAGGTGGTGG - Intronic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915088340 1:153404191-153404213 CTGTAGGGCTGCTGAGCAGGTGG - Intergenic
915451284 1:156007088-156007110 CAGTTGGGCAGGGGAGCCGGGGG + Intergenic
915552201 1:156641878-156641900 GAGTAGGGAGGAGGGGCAGGAGG - Intronic
915910758 1:159913860-159913882 GGCTAGGGCTGGGGGCCAGGGGG - Intergenic
916256673 1:162794926-162794948 CAGTGAGGCTGTGGGGCAGAAGG + Intronic
916399293 1:164428757-164428779 CAGTAGGGCTGCAGGTTAGGAGG - Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916599437 1:166277338-166277360 CTGTATGCCTGGGGGGCAGTTGG + Intergenic
917383819 1:174446099-174446121 GAGTAGGGCTTGGGCTCAGGTGG + Intronic
918264758 1:182831453-182831475 AAGTAGGGTTGGGGGGCAGTGGG + Intergenic
919058037 1:192595340-192595362 CAATAGGGGTAGGGAGCAGGAGG + Intergenic
919213730 1:194523040-194523062 CAGTAGAACTGGGAGTCAGGGGG + Intergenic
919449064 1:197748266-197748288 AAGTAGGGGTGGGGGGGTGGGGG + Intronic
919741694 1:200984834-200984856 AAGCAGGGCTGGAGGGCAAGTGG - Intronic
919759370 1:201087714-201087736 CAGGAGGGGTGGGGGGCGAGTGG - Intronic
919805349 1:201378023-201378045 GAGCAGGGTTGGGGGGCAGAAGG + Intronic
919880566 1:201898001-201898023 CAGTGGGGCTGGGGTGGATGTGG + Exonic
919970274 1:202572212-202572234 CAGTAGAGCTTGGGGCCAGTTGG + Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920420914 1:205832676-205832698 CAGAAGGGCTGACGGGGAGGGGG + Exonic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
921218459 1:212956321-212956343 CTTGAGGGCTAGGGGGCAGGAGG - Intronic
921469268 1:215529214-215529236 CAGTAGAGGTTGGGAGCAGGGGG - Intergenic
921671172 1:217925337-217925359 CCGAAGGCCTGGGAGGCAGGAGG - Intergenic
922095059 1:222436320-222436342 CAGTCCAGCTGGGGGGCACGCGG + Intergenic
922182373 1:223245524-223245546 CACGAGGGATGGGAGGCAGGCGG + Intronic
922460907 1:225813740-225813762 CAGCAGGGCGGGTGGGCATGAGG - Intronic
922721209 1:227901216-227901238 CAGGAGGGCTGGTGGGGCGGGGG - Intergenic
922740842 1:228013527-228013549 CAGCTGGGCCGGCGGGCAGGAGG + Intronic
922884238 1:229005825-229005847 CAGGAGGGTTGGGGGTGAGGGGG - Intergenic
923401576 1:233619924-233619946 CGGGGGGGCGGGGGGGCAGGGGG + Intronic
923525490 1:234769435-234769457 CAGCTGGCCTGGGGGGCATGTGG - Intergenic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923843545 1:237701676-237701698 CAGAAGGGTGAGGGGGCAGGAGG - Intronic
924190908 1:241551876-241551898 CATTAGGACTGGGGTGGAGGCGG + Intronic
1062908930 10:1199622-1199644 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1064137539 10:12763948-12763970 CAGGAGGGCTGTGGGGGTGGGGG - Intronic
1065390481 10:25176325-25176347 AGGGAGGGCCGGGGGGCAGGGGG + Intronic
1065764548 10:29015645-29015667 CTGTAGGCCTGGGAGGCAGGGGG - Intergenic
1065801757 10:29358703-29358725 CAGGAAGTTTGGGGGGCAGGGGG + Intergenic
1066723134 10:38360583-38360605 CAGTGAGGCTGTGGGGCAGAAGG + Intergenic
1067217189 10:44312974-44312996 GAGGAGTGCTGGGGAGCAGGAGG + Intergenic
1068650332 10:59515378-59515400 CACTAGGCCTGGGGAGCAGCGGG + Intergenic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1069621659 10:69841060-69841082 AAGTGGGGCAGGGGGGCAGTGGG - Intronic
1069800535 10:71078960-71078982 CCGCTGGGCTGGGGAGCAGGTGG - Intergenic
1069817816 10:71209761-71209783 CAATAAGGCTGGGGGGAAAGGGG - Intergenic
1070642546 10:78180119-78180141 GAGCAGGGCAGGGAGGCAGGCGG - Intergenic
1070644080 10:78189377-78189399 CAGTAGATCTGGGGTGCAGCTGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1071302684 10:84268185-84268207 CAGTAGGGCTGGCTGGGATGGGG + Intergenic
1071304539 10:84286833-84286855 GAGTAGGGGTGGGAGGAAGGTGG + Intergenic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1072251266 10:93584066-93584088 CAGTTGGGCAGGGTGTCAGGTGG - Intronic
1072271735 10:93783506-93783528 CAGTGGGGCTGTGGGGAGGGAGG + Intronic
1072407507 10:95168768-95168790 GAGTGGGGCAGGGGAGCAGGAGG + Intergenic
1072615936 10:97048924-97048946 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1073242467 10:102067248-102067270 GGGCCGGGCTGGGGGGCAGGGGG + Exonic
1073432355 10:103494496-103494518 CTGGAGGACTGGGGCGCAGGTGG + Intronic
1073900025 10:108209405-108209427 CACTAGGGCTAGGAGGTAGGGGG - Intergenic
1074033859 10:109717980-109718002 GAGCAGGGCTGAGGGGCAGAAGG + Intergenic
1074778836 10:116785833-116785855 TATTAGGGCAGTGGGGCAGGAGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075258395 10:120943392-120943414 CCATGGTGCTGGGGGGCAGGAGG + Intergenic
1075483294 10:122800155-122800177 CAGGAGGGACTGGGGGCAGGAGG + Intergenic
1075483343 10:122800268-122800290 AGGAAGGGCTTGGGGGCAGGAGG + Intergenic
1075779703 10:125009298-125009320 CAGGTGGCCTGGGAGGCAGGAGG + Intronic
1075929815 10:126286274-126286296 CAGCAGGTCTGGCAGGCAGGAGG + Intronic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1076178643 10:128388045-128388067 CAGTGGAGGTGGGAGGCAGGAGG + Intergenic
1076393628 10:130122018-130122040 CAGGAGGGCAGGAGAGCAGGGGG - Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076456325 10:130601157-130601179 TAGTGGGGCTTGGGGGCAGGTGG - Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076908251 10:133373701-133373723 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908254 10:133373709-133373731 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908257 10:133373717-133373739 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908260 10:133373725-133373747 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908263 10:133373733-133373755 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1077005996 11:356284-356306 CAGCAGGGCCGGGGCGCAGGGGG + Intergenic
1077066415 11:642855-642877 CAGGCGGGGTGAGGGGCAGGTGG + Intergenic
1077155140 11:1087740-1087762 CAGTAGTCCTGGGGGCCAGGAGG - Intergenic
1077327971 11:1971841-1971863 GAGGAGGGCTGGTGGGCAGCAGG - Intronic
1077333954 11:1995090-1995112 GAGGGGGGCTGGGGGGCATGGGG - Intergenic
1077365534 11:2160084-2160106 ACCTAGGGCTGGCGGGCAGGCGG - Intronic
1077405871 11:2382268-2382290 CGGTAGGGCTGGGGGACCAGGGG + Intronic
1077485200 11:2835271-2835293 CCAAAGGGCTGGGGTGCAGGGGG - Intronic
1077486089 11:2839017-2839039 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1078079277 11:8192410-8192432 CAGGAGGGCTTTGGGGCATGTGG - Intergenic
1078148444 11:8738590-8738612 CAGCAGGGATGGGGAGGAGGGGG - Intronic
1078552186 11:12288448-12288470 CAATAGGGCTGGGTCGCTGGGGG + Intronic
1078609552 11:12808593-12808615 CAGTGGGGAGGGGTGGCAGGTGG - Intronic
1078632010 11:13011095-13011117 GTGTAGGGGTGGGGGGCGGGGGG + Intergenic
1078658487 11:13264414-13264436 CAGTAGGGCCGTGGAGCTGGAGG + Intergenic
1079117903 11:17652235-17652257 AACTAGGGCTGGGGGGCTAGAGG - Intergenic
1079128635 11:17735282-17735304 GAGGAGGGCGGGCGGGCAGGCGG + Exonic
1080925424 11:36751354-36751376 CAGCTGGGCTGGGGGCCAAGGGG - Intergenic
1081526309 11:43930118-43930140 CACAGGGGCTGGGGGCCAGGTGG - Intronic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081963776 11:47157238-47157260 CCCTGGGGCTGGGGGGCTGGGGG - Intronic
1082278528 11:50246512-50246534 TGGGAGGGCTGGGGGGCAGGTGG - Intergenic
1083205544 11:61146589-61146611 AGGGAGGGCTGCGGGGCAGGCGG + Intronic
1083264890 11:61542142-61542164 AAGGAGATCTGGGGGGCAGGAGG + Intronic
1083594063 11:63910771-63910793 CAGTAGGAGTGTGGGGCAGGAGG - Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083885959 11:65573638-65573660 CTGAAGGGCTGGGGGGCAGGGGG + Exonic
1083891516 11:65598065-65598087 CAGTAGGGCAGGTGAGCTGGGGG + Exonic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084105351 11:66977043-66977065 CAGCAGGGGTGGGGGGGTGGGGG - Intergenic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084420577 11:69058588-69058610 CAGCAGGGCCCTGGGGCAGGCGG - Intronic
1084424415 11:69076811-69076833 CACGAGGGCAGGAGGGCAGGTGG - Intronic
1084424434 11:69076877-69076899 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424493 11:69077068-69077090 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424503 11:69077101-69077123 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084480146 11:69415322-69415344 CAGCAGAGGTGGGGGGCAGGAGG + Intergenic
1084516766 11:69641834-69641856 CAGCCGGGCTGGGGCGCAGGCGG - Intronic
1084545309 11:69812432-69812454 CAAGAGGGCTGGAGAGCAGGGGG - Intronic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084653581 11:70502709-70502731 CAGGACAGCTGGGGGGCAGTGGG - Intronic
1084711126 11:70844339-70844361 CATTTGGGTTGGGGGGCCGGGGG + Intronic
1084732587 11:71082941-71082963 CAGAAGGGTTGGGGGGGGGGCGG - Intronic
1084870851 11:72097745-72097767 CAGTGAGGCTGGGGGCCAAGGGG + Exonic
1084960214 11:72712565-72712587 GAGTGGGTCTCGGGGGCAGGAGG - Exonic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1086856111 11:91868060-91868082 CAGCAGGGCTGGGCAGAAGGAGG - Intergenic
1087309230 11:96521135-96521157 CAATACAGATGGGGGGCAGGGGG + Intergenic
1088692322 11:112338533-112338555 CAGTCAGGGTGGGAGGCAGGAGG - Intergenic
1089063113 11:115642410-115642432 CAGTAATGCAGGTGGGCAGGTGG + Intergenic
1089125571 11:116174241-116174263 CAGTTGGGTTGGGGGGGGGGCGG + Intergenic
1089495721 11:118907856-118907878 AATTAGGGCTGGAGGGGAGGGGG + Intronic
1089682176 11:120124804-120124826 CAGAAGGGTTGGGGTTCAGGAGG - Intronic
1089934121 11:122345771-122345793 CAGATGGGCTGAGGGGAAGGAGG - Intergenic
1090387436 11:126365088-126365110 CAGGAGGACTGGGTGGCGGGTGG + Intronic
1090390002 11:126382286-126382308 CAGGAGGACTGGGTGGCGGGTGG + Intronic
1090670286 11:128941040-128941062 CAGAAGGGCAGGGGTGCAGGGGG + Intronic
1090800635 11:130169459-130169481 CTGAAGGGGTGGGGGACAGGAGG + Intronic
1091219339 11:133920840-133920862 TGGAAGGGCCGGGGGGCAGGGGG + Exonic
1091286334 11:134410721-134410743 TACTAGGGCTGTGGGGCATGTGG - Intronic
1091349172 11:134879384-134879406 GAGCAGGACTTGGGGGCAGGGGG + Intergenic
1202810950 11_KI270721v1_random:27021-27043 GAGGAGGGCTGGTGGGCAGCAGG - Intergenic
1202816937 11_KI270721v1_random:50272-50294 GAGGGGGGCTGGGGGGCATGGGG - Intergenic
1091799740 12:3317304-3317326 CCGTGGGGCTGGGTGGCTGGTGG + Intergenic
1092157702 12:6295170-6295192 CAGCAGGGTTGGGGGGTGGGGGG - Intergenic
1092261140 12:6953878-6953900 CCGCAGGGATGGGGGGAAGGAGG - Intronic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1095063754 12:37738633-37738655 CAGTAGGGGTGTTGGGCTGGGGG + Intergenic
1095407004 12:41877917-41877939 CAGTCAGGCTGGGGTGCAGTGGG - Intergenic
1095446659 12:42288783-42288805 CAGAAGCCCTGGGGGACAGGAGG - Intronic
1096106626 12:48999794-48999816 CCATGGGGCTGGGGTGCAGGAGG + Intergenic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1096553637 12:52390222-52390244 CAGCAGGGGTGGGGGTCGGGGGG + Intergenic
1096738162 12:53672476-53672498 CAGCAAGGCTGGGGGAGAGGAGG - Intronic
1097185605 12:57194806-57194828 GAGTTGGGGTGTGGGGCAGGGGG - Intronic
1097286696 12:57883028-57883050 GAATAAGGGTGGGGGGCAGGAGG + Intergenic
1097327141 12:58289534-58289556 AAGAAGGGCTGGGAGGCAGTAGG + Intergenic
1097631099 12:62063160-62063182 CACTAGGGCTGTGTGGCAGGCGG - Intronic
1098272702 12:68784334-68784356 AATTAGGGCTGAGAGGCAGGTGG - Intronic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1099959584 12:89383883-89383905 CAGTAGGGCTGGGGGCGGGAGGG + Intergenic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1101883606 12:108642485-108642507 CAGGAGGGCTGGGTGGGAGATGG - Intergenic
1102173604 12:110860283-110860305 CAGTGGGTCTGGGGGGCAAGTGG + Intronic
1102223381 12:111210038-111210060 CCCCAGGGCTGGGGGGCTGGTGG + Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102512679 12:113426149-113426171 CAGAAGGGGTTTGGGGCAGGAGG - Intronic
1102644173 12:114393228-114393250 CAGCAAGGCTGGGGTGGAGGGGG - Intronic
1102745335 12:115244417-115244439 CACCAGGGCTGGGGAGCAGGAGG + Intergenic
1102872703 12:116426483-116426505 CAGGCGGGCTGGGGGCAAGGAGG + Intergenic
1103343652 12:120235105-120235127 CAGTAGGGATGGGGTGGGGGTGG - Intronic
1103386131 12:120534182-120534204 CAGTGGGGTTGGGGCGGAGGTGG + Intronic
1103450958 12:121028620-121028642 CAGTAGGGGGGGCGGGCGGGGGG - Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104051153 12:125194695-125194717 CAGTGGGGTTGGGGGGCACCTGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104620479 12:130308152-130308174 CCCCAGGCCTGGGGGGCAGGAGG - Intergenic
1104787618 12:131459835-131459857 GGGTAGCGCTGGGGGGTAGGGGG - Intergenic
1104833876 12:131774111-131774133 CAGTGTGGCTGCGGGGCACGGGG + Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105277987 13:18947360-18947382 CAGAGTGGCTGGGGTGCAGGAGG - Intergenic
1105843045 13:24272171-24272193 GGGCAGGGGTGGGGGGCAGGTGG + Intronic
1105913369 13:24891625-24891647 CAGTAGGGCTTGGGGGGACTGGG - Intronic
1106052662 13:26206199-26206221 CAGCAGGGACGGGGGGCAGTGGG - Intronic
1106209933 13:27632642-27632664 TAGGAGTGCTGGGGGGCGGGGGG - Intronic
1106500973 13:30328359-30328381 CCATGGGGCAGGGGGGCAGGGGG - Intergenic
1106599410 13:31175010-31175032 CAGTAATGCTGGGGGCCTGGTGG - Intergenic
1106907878 13:34427909-34427931 CACTGGGGCTGGGGAGGAGGTGG + Intergenic
1108020993 13:46127564-46127586 CAATGGGGCTGGGTGGGAGGCGG - Exonic
1108515290 13:51195806-51195828 CAGTAGGGGTGGGTGGGAGCAGG + Intergenic
1109274152 13:60285798-60285820 CTGTTGGGATGGGGTGCAGGGGG + Intergenic
1110363846 13:74659458-74659480 CAGTAGGGCTGGGGATCCTGTGG + Intergenic
1112708425 13:102099109-102099131 GAGAAGGGATGGGGAGCAGGAGG - Intronic
1113425749 13:110207106-110207128 GAGCTGGGCTGGGGGGCAGGAGG - Intronic
1113555457 13:111230474-111230496 CAGGAGGGGTGCGGGGCAGCAGG - Intronic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113747012 13:112752277-112752299 CAGTGGGGCTCGGGGCCGGGAGG + Intronic
1113814471 13:113161750-113161772 GAGGAGGACGGGGGGGCAGGGGG - Intronic
1115503844 14:34075279-34075301 CCTGAGGGCTTGGGGGCAGGAGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115694404 14:35881232-35881254 CTGTATGCCTGGGGGGCAGTTGG - Intronic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1115905569 14:38199344-38199366 CAGTATGGCAGGCAGGCAGGTGG - Intergenic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1118772671 14:68952594-68952616 CAGCAGGGATGGGGGGTGGGCGG - Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121312008 14:92940437-92940459 CAGAAGCGATGGGGGGCGGGTGG + Exonic
1121439369 14:93939157-93939179 CTGGAGGGCTGCGGGGCCGGCGG + Exonic
1121958914 14:98240631-98240653 CAGCAGGGGTGAGAGGCAGGAGG - Intergenic
1122160125 14:99777563-99777585 CAGCTGGGCTTGGTGGCAGGTGG - Intronic
1122230532 14:100304556-100304578 AAGCAGGGCCTGGGGGCAGGGGG + Intronic
1122323557 14:100869307-100869329 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1122323744 14:100870349-100870371 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1122640485 14:103156471-103156493 CAGGTGGGCTGAGGGGCCGGCGG + Intergenic
1122652326 14:103232510-103232532 GGGCAGGGCTGGGAGGCAGGAGG + Intergenic
1122652347 14:103232573-103232595 GGGTGGGGCTGGGAGGCAGGAGG + Intergenic
1122721966 14:103727354-103727376 CAGAGGGGGCGGGGGGCAGGTGG - Intronic
1122740055 14:103867082-103867104 CTGCAGGGCTGGGGGGGTGGGGG + Intergenic
1122889178 14:104724662-104724684 GAGTAGGGGTGGGTGGAAGGAGG - Intronic
1122950845 14:105043679-105043701 CCGTGGGGCTGGGGGGCTGGGGG + Intergenic
1123036306 14:105473319-105473341 CAGTCGGGCGGGGGGGCGGGGGG + Exonic
1123631196 15:22260833-22260855 CCTTGGGGCTGGGGGGGAGGGGG - Intergenic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1123717799 15:23043126-23043148 CAGAGGTGCTGGGGGGCGGGGGG + Intergenic
1123718483 15:23045494-23045516 CAGAGGTGCTGGGGGGCGGGGGG + Intergenic
1123719445 15:23048837-23048859 CAGAGGTGCTGGGGGGCGGGGGG + Intergenic
1123724117 15:23085225-23085247 CAGAAGTGCTGGGTGGCTGGAGG + Intergenic
1124003170 15:25776490-25776512 CAGTAGGCCTGGCGTGCAGGAGG + Intronic
1124346365 15:28924060-28924082 CAGCAGGGCAACGGGGCAGGGGG - Intronic
1124653320 15:31488347-31488369 CAGAAGGGCTAGGGTGGAGGGGG + Intronic
1124879515 15:33628314-33628336 GAGGAGGGCTGGGGAGCATGTGG + Intronic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125599362 15:40906962-40906984 CAGTAGGGCTGGGGGAGTGGAGG - Intergenic
1125732635 15:41901983-41902005 GAGTAGGGCTGGGGAGCACGAGG + Intronic
1126122194 15:45263431-45263453 CAACATTGCTGGGGGGCAGGAGG + Intronic
1126176519 15:45740939-45740961 GAGTAGGCCTGGGGGACAAGGGG - Intergenic
1127345138 15:58087679-58087701 GGGAAGGGCTGGGGAGCAGGTGG + Intronic
1128160218 15:65418724-65418746 CAGGCAGGCTTGGGGGCAGGGGG - Intronic
1128324010 15:66711808-66711830 CTGGAGGGCTGGAGGGCTGGAGG + Intronic
1128332700 15:66766197-66766219 TGGAAGGGATGGGGGGCAGGGGG + Intronic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128570482 15:68729966-68729988 CAGGAAGGCTGGGGGGGCGGGGG - Intergenic
1128641457 15:69341184-69341206 CAGTCTGGCAGGGGGGCCGGGGG - Intronic
1128905104 15:71460467-71460489 CAGTAGGGCTGGATGGCATGTGG + Intronic
1129261905 15:74373410-74373432 CAGTAGGTAGTGGGGGCAGGAGG + Intergenic
1129454548 15:75669752-75669774 CAGGAGGGCTGTTGGGCAGGGGG + Intergenic
1129856742 15:78830426-78830448 AAGCAGGGCTGGCGGGCAGGGGG + Intronic
1129880563 15:79003753-79003775 CAGTGGGGCTGGGAGGCTGGGGG + Intronic
1130038186 15:80380440-80380462 CTGTAGGGCAGTGGGACAGGGGG + Intronic
1130038902 15:80387157-80387179 CAGTAGGGATGAGGGGGCGGGGG + Intronic
1130149546 15:81300710-81300732 CAGGAGGGCTGGGAGGTAGGAGG + Intronic
1130301301 15:82681254-82681276 CAATAAGGCTGGGGTGCAGGAGG - Intronic
1130902361 15:88216622-88216644 AAGGATGGCTGGGTGGCAGGAGG - Intronic
1131232605 15:90670579-90670601 CTGGAGGGGTGGGGAGCAGGGGG + Intergenic
1131455318 15:92578913-92578935 CAGGAGGGCTAGTGGGGAGGAGG - Intergenic
1131502114 15:92978412-92978434 CTTTAGGGTTGGGGGCCAGGGGG + Intronic
1132151195 15:99460773-99460795 AATTAGGGTTGGGGGGCTGGGGG + Intergenic
1132476050 16:138528-138550 GAGTAGGGCAGGGGTGGAGGCGG + Intronic
1132506701 16:313615-313637 TAGGATGGCTGGTGGGCAGGTGG + Intronic
1132514576 16:360181-360203 CAGGTGGGCGGGGGCGCAGGTGG - Intergenic
1132595242 16:746170-746192 CTGTCTGGCTGGGTGGCAGGAGG + Intronic
1132745623 16:1435009-1435031 CAGCAGGGCAGGCGGGGAGGCGG + Intronic
1132767359 16:1541272-1541294 CAGGAGGTGAGGGGGGCAGGTGG + Intronic
1132929056 16:2449397-2449419 CAGGCGGGCTGGGGCGTAGGCGG - Exonic
1132944854 16:2527257-2527279 GAGCAGGGCTGGGAGGCAGGAGG - Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133521619 16:6563740-6563762 CAGTAGGGCTTGGGAGGTGGAGG + Intronic
1133676438 16:8077643-8077665 AAGTAGGTCAGGGTGGCAGGAGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1135040331 16:19113368-19113390 TAGTAGAGATGGGGGGCGGGGGG + Intergenic
1135234395 16:20741940-20741962 CAGTCGGGAGGCGGGGCAGGAGG - Exonic
1135601151 16:23784704-23784726 AAGTAGGAATGGGGTGCAGGTGG + Intergenic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1137872908 16:51967773-51967795 GGGAGGGGCTGGGGGGCAGGAGG - Intergenic
1138352140 16:56351779-56351801 CAGGAGTGGTGGGGAGCAGGGGG + Intronic
1138352529 16:56353553-56353575 CAGCATGGCTGGGTGGCAGCAGG + Intronic
1138455325 16:57117533-57117555 CACTAAGCCTGGCGGGCAGGAGG + Exonic
1138505943 16:57478357-57478379 GAGTGGGGTTGGGGGGCATGCGG - Intronic
1138573857 16:57893944-57893966 CAATAGGTCTGGGAGGCTGGCGG - Intronic
1138584804 16:57962789-57962811 CAGCAGGGCTGAGGGGCTGAGGG - Intronic
1139581927 16:67878881-67878903 GAGGAAGGCCGGGGGGCAGGTGG + Intronic
1139599162 16:67976285-67976307 GACTAGGGCTGGTGGGCAGCGGG - Intronic
1139773058 16:69294841-69294863 CACTCGGGCTGGAGGGCTGGAGG + Intronic
1139953193 16:70681689-70681711 CAGGAGGGGAGGGGAGCAGGGGG - Intronic
1140805657 16:78530050-78530072 CAGAAGGGGTGGAGTGCAGGGGG - Intronic
1141425278 16:83940758-83940780 CCGCAGGGCTGGGGGATAGGAGG + Intronic
1141452920 16:84117401-84117423 CCGTGGGGCCGGGGGTCAGGAGG - Intergenic
1141605093 16:85148287-85148309 GCTTAGGGCTGGGGGCCAGGGGG - Intergenic
1142028839 16:87828520-87828542 CAGCTGGGCTGGGGGCCAGGCGG + Intergenic
1142138437 16:88461982-88462004 CAGTAGGGCTGGTGGCCTGGGGG - Intronic
1142248979 16:88982577-88982599 CGGGAGGGCTGTGGGGGAGGAGG - Intergenic
1142253300 16:89002496-89002518 CAGAAGAGCTGGGGGGACGGAGG + Intergenic
1142520122 17:498618-498640 CAGCAAGGCTGGGAGGCTGGTGG + Intergenic
1142567919 17:852628-852650 AAGTAGGGCTGGGTGGGTGGAGG + Intronic
1142608518 17:1095577-1095599 CAGCAGGACTGGGGAGGAGGGGG - Intronic
1142975467 17:3641123-3641145 CAGCAGGGCTAGGGGTCAGTTGG + Intronic
1142998792 17:3777515-3777537 GAGTAGGGCCGGTGGGCAAGAGG - Intronic
1143031694 17:3971501-3971523 TGGGAGGGCTGGGGGGCAGCGGG + Intergenic
1143282484 17:5765251-5765273 GAGTGGGGCTGGGAGTCAGGTGG - Intergenic
1143328649 17:6118374-6118396 CAGCAGGCATGGGGGGCAAGGGG - Intronic
1143512603 17:7404778-7404800 CCGGAGGGCGGGCGGGCAGGCGG + Intergenic
1143558310 17:7676317-7676339 CTGGAGGGCTGGGGGGCTGGGGG - Intronic
1144440655 17:15278343-15278365 AAGGTGGGGTGGGGGGCAGGCGG - Intergenic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144650057 17:17001824-17001846 CATTCAGGCTGGGGTGCAGGGGG - Intergenic
1144650200 17:17002451-17002473 CATTCAGGCTGGGGTGCAGGGGG - Intergenic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144832762 17:18140663-18140685 GAGGTGGGGTGGGGGGCAGGTGG + Exonic
1144872065 17:18377820-18377842 AAGGAGGGCAGGAGGGCAGGTGG - Exonic
1144966251 17:19078533-19078555 AAGGAGGGCAGGGGGCCAGGTGG + Intergenic
1144981667 17:19173524-19173546 AAGGAGGGCAGGGGGCCAGGTGG - Intergenic
1144986557 17:19204715-19204737 AAGGAGGGCAGGGGGCCAGGTGG + Intergenic
1145016647 17:19403132-19403154 CACTGGGCCTGGGGGACAGGAGG + Intergenic
1145255151 17:21318279-21318301 CAGCAGGGCTGTGCGGGAGGTGG + Intergenic
1145321455 17:21769676-21769698 CAGCAGGGCTGTGCGGGAGGTGG - Intergenic
1145389472 17:22444441-22444463 CAGGAAAGCTGGGAGGCAGGAGG - Intergenic
1145788854 17:27611656-27611678 CAGTAGGGCTGGAGGTGGGGTGG + Intronic
1145976354 17:28986385-28986407 TGGTGGGGCTGGGGCGCAGGTGG - Intronic
1146022517 17:29292601-29292623 CAGGAGGCCTGGGGGGGCGGCGG - Intronic
1146306376 17:31732876-31732898 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
1146646728 17:34581290-34581312 CCGGAGGGCTCGGGGGCTGGCGG - Intronic
1146726612 17:35161564-35161586 CAGTAGGGCTGGGGAGTAACAGG - Intronic
1147370477 17:39989229-39989251 CAGTGGGGCTGAGGAGCAGGAGG - Intronic
1147376302 17:40024107-40024129 TGGTAGGGCGGGGGGGAAGGTGG + Intronic
1147759013 17:42785547-42785569 CAACAGGGATGGGGCGCAGGAGG + Intronic
1147783819 17:42963690-42963712 TAGTGGTGCTGGGGGGCAGAGGG - Intronic
1147871621 17:43591703-43591725 GCCTAGGGCTGGGGGGCTGGGGG + Intergenic
1147912201 17:43862410-43862432 CTGAAGGGCTGGGATGCAGGTGG - Exonic
1148029126 17:44608029-44608051 CAGGAGCTCTTGGGGGCAGGTGG + Intergenic
1148203708 17:45766326-45766348 CAGTAGGGAGGTGGGGAAGGCGG - Intergenic
1148348035 17:46917083-46917105 AAATTTGGCTGGGGGGCAGGGGG - Intergenic
1148521725 17:48283181-48283203 CAGTTATGCTGGGTGGCAGGGGG - Intronic
1148552450 17:48558589-48558611 GATTAGGGCTGGGAGGCTGGAGG + Intronic
1148618430 17:49016795-49016817 CAGGAGGACAGGGGGGCGGGCGG - Intronic
1148742033 17:49898406-49898428 CAGCAGGGCTGGGAGGGAAGAGG - Intergenic
1148743304 17:49905091-49905113 CAGTAGGTCTGGGGCACAGTAGG + Intergenic
1148763967 17:50026870-50026892 CAGCATGGCTGAGAGGCAGGAGG + Intergenic
1148837335 17:50472320-50472342 CAGTTGGGTTGGGGGGTTGGGGG + Intronic
1149656416 17:58311714-58311736 CAGGTGGGCCTGGGGGCAGGGGG + Exonic
1149689721 17:58565101-58565123 CAGGAGAGCAGGGGGCCAGGTGG + Intronic
1149893691 17:60412411-60412433 CGGTGGGGCGGGGGAGCAGGTGG + Intronic
1150007472 17:61478793-61478815 AAGTGGGGCTGTGGGGCAGTGGG - Intronic
1150225039 17:63519888-63519910 TGGTGAGGCTGGGGGGCAGGAGG + Intronic
1150284873 17:63949007-63949029 CACTGGGGCTGGGGGCCAGGAGG - Intronic
1150390354 17:64786527-64786549 GGGTAGGGCTGGGAGGCAGCTGG + Intergenic
1150434869 17:65145941-65145963 AAGAAGGGCTGGGTGGGAGGAGG - Intronic
1150573943 17:66413320-66413342 CAGTAGGGCATGTAGGCAGGGGG + Intronic
1150613102 17:66749282-66749304 CCGGAGGGGTGGAGGGCAGGGGG - Intronic
1150798038 17:68255208-68255230 CAGTAGGTCTGGGAGAAAGGGGG - Intronic
1151155393 17:72120802-72120824 CGGTAGGGTGGGGGGGCGGGGGG - Intergenic
1151381654 17:73729957-73729979 CAGAAGGGGTGGGCAGCAGGGGG + Intergenic
1151407998 17:73902036-73902058 CAGTGGAGATGGGGGGCGGGGGG - Intergenic
1151466503 17:74289163-74289185 CAGCAGGGCTGGAGGGCAACAGG - Intronic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1151997390 17:77618508-77618530 CAGCAAGGGTAGGGGGCAGGAGG + Intergenic
1152098381 17:78286446-78286468 AGGCAGGGGTGGGGGGCAGGAGG - Intergenic
1152526073 17:80888974-80888996 CAGGAGGGCAGTGGGGCAGGTGG + Intronic
1152560367 17:81075644-81075666 AAGGAGGGCTGGTGGACAGGTGG - Intronic
1152626052 17:81388441-81388463 CTCCAGGGCTGGAGGGCAGGTGG + Intergenic
1152699956 17:81813802-81813824 CACTGGGGGTGGGGGGTAGGTGG - Exonic
1152718102 17:81909468-81909490 CAGGAGGGCTGGGGGGCCGCGGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152740736 17:82017233-82017255 CAGCCGGGCTGGTGGGCGGGTGG + Intronic
1152741841 17:82021888-82021910 CAGCAGGCGTGGGGGGCGGGGGG - Intronic
1152757436 17:82092856-82092878 CCGGGGTGCTGGGGGGCAGGTGG - Intronic
1152982348 18:290336-290358 CTGTCGGGGTGGGGGGCAAGAGG + Intergenic
1153201831 18:2655497-2655519 GAGCAGGGCTCGGGGGCAGCGGG - Intergenic
1153641988 18:7165329-7165351 CAGTGGTTCTGGGGGGCTGGGGG + Intergenic
1155052637 18:22162046-22162068 TGGCTGGGCTGGGGGGCAGGAGG + Intergenic
1156231628 18:35158750-35158772 TAGGAGGGGTGGGGAGCAGGAGG + Intergenic
1156451128 18:37266968-37266990 CAGAAGGGCTGTGGGGAAAGGGG + Intronic
1156457875 18:37304873-37304895 CAGAAGGGAGGGGGAGCAGGTGG + Intronic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1156718692 18:40043658-40043680 CAGTTGGTTTGGGGGGCATGAGG - Intergenic
1156722473 18:40086920-40086942 GAGTAGGGCAAGGGAGCAGGAGG + Intergenic
1157176470 18:45456898-45456920 CAGTAGGGTTGGGAAGCATGAGG + Intronic
1157288672 18:46394502-46394524 CAGCCTGGCTGGGGGGAAGGTGG - Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1158115574 18:53991605-53991627 CAGTAGGGCTGGGGAGGTGCTGG + Intergenic
1158533817 18:58289275-58289297 GAGAGGGGCTGAGGGGCAGGTGG + Intronic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1158835511 18:61327511-61327533 CTGAAGGGATGGGGTGCAGGTGG - Intergenic
1158931574 18:62328683-62328705 CGGATGGGATGGGGGGCAGGAGG - Intronic
1159771230 18:72547344-72547366 CAGAAGGGCAGGAGGGTAGGAGG + Intronic
1160458416 18:79019188-79019210 CAGGAGGTCTGTGGGGGAGGAGG - Intergenic
1160848973 19:1180623-1180645 CAGGAGGGCTGGCAGGGAGGAGG - Intronic
1160969724 19:1762240-1762262 CAGGAGGGTTGGAGGGCTGGCGG - Intronic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1160969733 19:1762264-1762286 GAGGAGGGCAGGAGGGCAGGAGG - Intronic
1160980823 19:1815841-1815863 CCAGAGGGCTGGGGGGCAGAGGG + Exonic
1161245510 19:3249571-3249593 CATTAGGGATGGGAGGCAAGGGG - Intronic
1161398787 19:4058680-4058702 CTGCTGGGCTGGGGGACAGGAGG - Intronic
1161620007 19:5292869-5292891 AGGTCGGGCTGGGGGCCAGGCGG + Intronic
1161742613 19:6032556-6032578 CAGCAGGGCTGAGAGGCTGGGGG + Intronic
1162015892 19:7846345-7846367 CAGCTGGGCTGGGGCGCATGGGG + Intronic
1162032364 19:7923024-7923046 CAGTGGGGCTTGGGGACTGGGGG - Exonic
1162406674 19:10479028-10479050 GAGTAGGGCTAAGGGGCGGGGGG + Intergenic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162913697 19:13863537-13863559 AAGAAGGGCTGGCCGGCAGGGGG + Intronic
1163126514 19:15247176-15247198 GAGTGGGGCTGGGGGGTGGGTGG - Intronic
1163155487 19:15437967-15437989 CACTAGGGGTTGGGGGCAAGGGG - Intronic
1163304252 19:16467809-16467831 CAGCAGGGCTCTGCGGCAGGAGG + Intronic
1163430192 19:17262761-17262783 CAGAATGGCTGGGGGGCTGGTGG + Exonic
1163613619 19:18313320-18313342 CAGGGTGGCTGGGGGCCAGGTGG + Intronic
1164555147 19:29245678-29245700 CAGCAGGCCTGGGAGGCAGATGG + Intergenic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165050641 19:33139325-33139347 CAGGAGGGCTGGGGAGGAGCAGG + Intronic
1165059784 19:33199539-33199561 CAGAGGGGATGGGAGGCAGGAGG - Intronic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165389313 19:35529343-35529365 CCCAAGGGCTGGGAGGCAGGAGG - Intergenic
1165712669 19:38023249-38023271 CGGTGGGGCCGGGGGTCAGGGGG + Intronic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1165902333 19:39174670-39174692 GGCTAGTGCTGGGGGGCAGGTGG - Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166142448 19:40812239-40812261 CACTAGGGCTGGGGGCGGGGTGG - Intronic
1166234012 19:41442822-41442844 AAGTGGTGGTGGGGGGCAGGTGG + Intergenic
1166449038 19:42881723-42881745 CAGTTGGGCTTGGGAGCAGCAGG + Intronic
1166738528 19:45100330-45100352 CAGTAGGGCATGGGGGCAGGTGG + Intronic
1167017084 19:46848225-46848247 CAGGTGTGATGGGGGGCAGGGGG + Intronic
1167217099 19:48171826-48171848 CGGCACGGCTGCGGGGCAGGAGG + Exonic
1167426122 19:49430580-49430602 TAGGAGGGCGGGGGTGCAGGGGG + Exonic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1167736663 19:51298579-51298601 CTGTAGGGCAGGCAGGCAGGAGG + Intergenic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168073382 19:53964834-53964856 CTGTGAGGCTGGGGTGCAGGAGG - Intronic
1168077611 19:53990066-53990088 CAGAAGGGCTGAGGGGTAGGGGG + Exonic
1168112805 19:54203774-54203796 CAGTTGTGCTGGGGGGTGGGGGG - Intronic
1168292916 19:55365807-55365829 GAGCAGGGGTGGGAGGCAGGTGG - Exonic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925154565 2:1639612-1639634 CATGAGGGCTGGGGCACAGGTGG - Intronic
925164810 2:1709448-1709470 CAGCGGGGCTGGGGTGCAGCGGG + Intronic
925164815 2:1709464-1709486 CAGCGGGGCTGGGGTGCAGCAGG + Intronic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925385953 2:3461810-3461832 CACCAGGGCAGGGGAGCAGGAGG - Intronic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
926010027 2:9400237-9400259 CAGGAGGGGAAGGGGGCAGGAGG - Intronic
926332345 2:11835984-11836006 CAGGAGGGGTGTGGGGGAGGGGG - Intergenic
926683090 2:15678661-15678683 CTGGGGGGCTGGGGGGCTGGAGG + Intergenic
926884182 2:17582217-17582239 CAGGAGGGGTGAGGGGAAGGAGG + Intronic
926989082 2:18657744-18657766 CAGTGGGGCCGAGGTGCAGGTGG - Intergenic
927194685 2:20539375-20539397 CACTAGGGCAGGAGGGGAGGTGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927705208 2:25292556-25292578 CAGCACAGCTGGGGGGCAGAGGG - Intronic
927850854 2:26498406-26498428 CAGGAGGGGTGGGAGGCAGCAGG - Intronic
928209423 2:29312531-29312553 CTGTTGGGCTGTGGGGCAGGAGG + Intronic
928463255 2:31495630-31495652 CTGTCGGGGTGGGGAGCAGGGGG + Intergenic
928537844 2:32257653-32257675 TAGTTGGGCTGGGGTGGAGGTGG + Intronic
929570801 2:43021872-43021894 GAGGAGGGCTGGATGGCAGGCGG - Intergenic
929592829 2:43158182-43158204 TACTGGGGCTGGGGGCCAGGAGG - Intergenic
929601253 2:43206169-43206191 CAGGAGGGCTGGGCTGGAGGAGG + Intergenic
929709327 2:44250159-44250181 CAGTTGGGCAGGGGAGCTGGAGG + Intergenic
929942234 2:46343124-46343146 CAGTAGTGCTGGGAGGGTGGGGG - Intronic
930064830 2:47319871-47319893 GAGAAAGGCTGGCGGGCAGGTGG - Intergenic
930722575 2:54651972-54651994 CAGTAGGGCTTGTGGGGAGGTGG - Intronic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
931392387 2:61855017-61855039 TCGTAGGGCTGGGGAGCAGGAGG - Intergenic
931484570 2:62677075-62677097 AGGTAGAGCTGGGGGGCAAGGGG + Intronic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932909852 2:75794050-75794072 CAGTAGGGGTGATGGTCAGGGGG + Intergenic
933840741 2:86284009-86284031 AAGTAGGCCTGGGGGTGAGGGGG + Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934887498 2:98037795-98037817 CAGAAAGGCTGGGAGGCAGCAGG + Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935455483 2:103262526-103262548 TAGCAGAGTTGGGGGGCAGGGGG + Intergenic
935498550 2:103810277-103810299 CAGGAAAGGTGGGGGGCAGGAGG + Intergenic
935744497 2:106178827-106178849 CAGGAAGGCTGGGGGGCACTGGG - Intronic
936095645 2:109528655-109528677 CAGCAGGGCCGTGGGGCAGGAGG + Intergenic
936504355 2:113093274-113093296 CAGCATGGCCGGGGAGCAGGAGG - Intergenic
936526322 2:113244200-113244222 CACTATGGCTGGGGGCCAGGGGG + Intronic
936843072 2:116797453-116797475 CAGTAGGGATGTGGGGGAGTGGG + Intergenic
937206166 2:120238536-120238558 GAGCAGGGCTGGGGTGGAGGAGG + Intergenic
937308999 2:120890307-120890329 CAGTAGGGGTGAGGGAGAGGAGG + Intronic
937358496 2:121213042-121213064 CATCATGGCTGGGGGGGAGGGGG + Intergenic
937690671 2:124751210-124751232 AAGTAGGGGTTGGGGGTAGGGGG + Intronic
937989576 2:127654762-127654784 CAGCAGTGGCGGGGGGCAGGGGG - Intronic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938143044 2:128812161-128812183 CAGCAGGGCTTTGGGGCAGGTGG - Intergenic
938240262 2:129737918-129737940 CAGGAGGGCAGGAGAGCAGGAGG - Intergenic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938264947 2:129921992-129922014 CAGGGGGGGTGGGGGGCAGCAGG + Intergenic
938423787 2:131167249-131167271 CTGTCGGGGTGGGGGGCAAGTGG - Intronic
939585481 2:143999170-143999192 GAGTAGGGCTAGGAGGCATGTGG + Intronic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
941966501 2:171305773-171305795 CACCAGGGCTGGGTGACAGGGGG - Intergenic
942055923 2:172181964-172181986 CAGGGAGGCTGAGGGGCAGGCGG + Intergenic
942130269 2:172871835-172871857 CAGTAGTTCTGGGTGGCAGTTGG + Intronic
942178347 2:173355677-173355699 GAGTAAGGCTGGGGGGTGGGGGG - Intronic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943756610 2:191563678-191563700 TAGTGGGGGTGGGAGGCAGGTGG + Intergenic
943926132 2:193782890-193782912 CTGTCGGGGTGAGGGGCAGGGGG - Intergenic
945030609 2:205660063-205660085 CTGTGGGGCTGGGCAGCAGGTGG + Intergenic
945194270 2:207223787-207223809 CAGTAGGGATGGGGGCTAAGTGG - Intergenic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
948095984 2:235334407-235334429 CTGCAGGGCTGTGGGGTAGGGGG - Intergenic
948306844 2:236954727-236954749 CTGCAGGGCTGGGGTGCAGAAGG + Intergenic
948479148 2:238239618-238239640 CCGTGGGGCTGCGGGGCGGGCGG - Intronic
948863383 2:240763641-240763663 CACAGGGGCTTGGGGGCAGGAGG - Intronic
948865141 2:240771396-240771418 GGGCAGGCCTGGGGGGCAGGCGG - Intronic
948942528 2:241203509-241203531 CAGGTGGTCTGGGGGGCAGCGGG - Intronic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
949041777 2:241852931-241852953 GAGCAGGGCTGGGGAGAAGGTGG + Exonic
1168760731 20:347892-347914 GAGTAGGTCTGGCGGGCGGGGGG - Intronic
1169972184 20:11279939-11279961 CAGGAGGGCTGTGCTGCAGGTGG - Intergenic
1171152811 20:22842657-22842679 TAGTAGGGCTGGGAGCAAGGTGG + Intergenic
1171259286 20:23717709-23717731 CACATGGGCTGGGGGTCAGGGGG + Intergenic
1172271189 20:33656667-33656689 CAGTAATGGAGGGGGGCAGGAGG + Intergenic
1172389900 20:34559320-34559342 GAGCAGGGCGGGCGGGCAGGGGG - Intronic
1172650629 20:36499363-36499385 CAGGCGGGCGGGCGGGCAGGTGG - Intronic
1172666878 20:36606168-36606190 GAGTAGGGCAGTGGGGCGGGTGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173229783 20:41185244-41185266 CAGGCTGCCTGGGGGGCAGGTGG - Intronic
1173652938 20:44678782-44678804 GGGTTGGCCTGGGGGGCAGGCGG + Intergenic
1173736924 20:45368548-45368570 CTGTAGGGCTGAGAGTCAGGAGG - Exonic
1173878506 20:46392641-46392663 CAGGAGTGCTGGGTGGCTGGAGG - Intronic
1173940300 20:46905324-46905346 CAGGAGGGCTGTGGGTCATGTGG - Intronic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174185602 20:48703821-48703843 CAGCAGGGCTGGGGTGGAGGGGG - Intronic
1174420998 20:50399173-50399195 AAGCAGGGCTGTGGGGGAGGGGG - Intergenic
1174557898 20:51408883-51408905 CAGCAGGACTGGGGTGGAGGTGG + Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175191416 20:57214532-57214554 GAGGAGGGCTGGGTGGGAGGAGG - Intronic
1175222852 20:57427139-57427161 CAGTGGGCCTGTGGGGGAGGGGG + Intergenic
1175224822 20:57439100-57439122 GAGCAGGGCAGGGGGGCGGGAGG - Intergenic
1175390594 20:58624920-58624942 CGGCAGGGCTGGAGAGCAGGGGG + Intergenic
1175885429 20:62287932-62287954 CAGGAGGGAGGCGGGGCAGGTGG + Intronic
1175935273 20:62511115-62511137 CAGGAGGGGTGGAGGTCAGGAGG - Intergenic
1176026087 20:62986349-62986371 CAGGTGGACTGGGGTGCAGGTGG + Intergenic
1176093383 20:63328809-63328831 CAGGAGGGCGGGAGGGCGGGAGG - Intronic
1176139366 20:63538293-63538315 CTCAGGGGCTGGGGGGCAGGCGG - Intergenic
1176151294 20:63592439-63592461 CAGAAGGGCCTAGGGGCAGGAGG + Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176277206 20:64279180-64279202 CAGGAGGGATGGGGTGGAGGTGG - Intronic
1177758255 21:25373569-25373591 GAGGAGGGGTGGGGAGCAGGAGG - Intergenic
1177855648 21:26397729-26397751 CTGGAGTGCTGAGGGGCAGGGGG + Intergenic
1178037529 21:28601331-28601353 CAGTAAGGCTGGGGAACAGGGGG - Intergenic
1178235529 21:30836890-30836912 CAATAGAGCTGGGGAGAAGGGGG + Intergenic
1178375959 21:32067677-32067699 GAGGAGAGCTGGGGGGCAGAGGG + Intergenic
1178743522 21:35225887-35225909 CAGTGGCTCTGAGGGGCAGGTGG + Intronic
1178913422 21:36693872-36693894 CAGAAAGGCCGGCGGGCAGGCGG - Intergenic
1179162911 21:38912585-38912607 CCGGGGGGCTGGGGGGTAGGGGG + Intergenic
1179502849 21:41820904-41820926 CAGCAGGGCTCGGGGGCAGCTGG - Intronic
1179576177 21:42309900-42309922 CCGTCGGGCTGGGGGGTGGGTGG + Intergenic
1179607570 21:42527211-42527233 CTGTTGGGCTGGGGGGCTGTTGG + Intronic
1180066273 21:45414108-45414130 CAGGAGGGCCTGGGGCCAGGCGG - Intronic
1180162476 21:46004373-46004395 CAGGAGGGAGGGCGGGCAGGAGG - Exonic
1180844731 22:18974869-18974891 CAGCAGGGCAGCGGGGCATGGGG + Intergenic
1180881026 22:19203648-19203670 CAGTGGGGGTGTGGGGCTGGGGG - Intronic
1180996979 22:19970579-19970601 GAGTGGGGTGGGGGGGCAGGAGG + Exonic
1181056740 22:20263843-20263865 CAGCAGGGCAGCGGGGCATGGGG - Intronic
1181436750 22:22915598-22915620 CAGAATGGATGAGGGGCAGGAGG - Intergenic
1181487211 22:23238867-23238889 CAAGGGGGGTGGGGGGCAGGTGG + Intronic
1181694968 22:24588473-24588495 CAGCCGGGTTGGGGGGTAGGAGG - Intronic
1182069754 22:27455259-27455281 TAGCAGGACTGGGGAGCAGGGGG - Intergenic
1182098567 22:27642161-27642183 CAGCAGGGGTCGAGGGCAGGGGG + Intergenic
1182290794 22:29278041-29278063 CTGTATGCCTGGGGGGCAGTTGG - Exonic
1182434914 22:30324446-30324468 CTGTAGGGCTGGGGCTGAGGTGG - Intronic
1182546445 22:31079447-31079469 CAGTAGGGCAGGGAGAAAGGAGG + Intronic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1183030774 22:35102864-35102886 CTGCAGGGCTGTGGGGGAGGAGG - Intergenic
1183045503 22:35216404-35216426 CAGTAGGGTTGGGAGCCAGATGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183622362 22:38982008-38982030 CATTAGGGCTGGGGAGGGGGTGG + Intronic
1183627525 22:39013907-39013929 CATTAGGGCTGGGGAGGGGGTGG + Intergenic
1183702392 22:39457698-39457720 CACTGGGGCTGGGGGCCCGGAGG + Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184760277 22:46539718-46539740 CAGGAGGGCTCTGGGGGAGGAGG + Intergenic
1184980064 22:48089599-48089621 CAGCAGGGGTGGGAGGCAGGCGG + Intergenic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
1185316714 22:50182468-50182490 CAGTAGTCCTTGGGGGCAGCCGG + Intergenic
1185331667 22:50254783-50254805 CAGCAGGTCTGGGGGCCAGGAGG + Intronic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
950163072 3:10774452-10774474 GACTAGGGCTGGGGAGAAGGAGG + Intergenic
951078355 3:18424414-18424436 CAGCGAGGGTGGGGGGCAGGGGG + Exonic
951825128 3:26859853-26859875 CAGGAGGACTGGGGCGGAGGTGG - Intergenic
952057377 3:29464230-29464252 CAGTAAGACTGGGAGGTAGGAGG + Intronic
952992681 3:38845243-38845265 CAAAAGGGCTTGGGAGCAGGAGG - Intergenic
953496311 3:43390280-43390302 CAGAAGGGCAGTGGGGAAGGAGG - Intronic
953763864 3:45717716-45717738 CACTGTGGCTGGGGAGCAGGGGG - Intronic
953878850 3:46681309-46681331 CTGAAGGGCTGGGGGGCCTGCGG + Exonic
954397065 3:50298575-50298597 CAGTAGGGTTTGGGCACAGGAGG - Intronic
954464556 3:50646868-50646890 GAGTGGGGCTGCCGGGCAGGAGG + Intronic
954863565 3:53710257-53710279 CAGGAGGGGTCTGGGGCAGGCGG + Intronic
954912674 3:54122358-54122380 CGGGAGGGCGGCGGGGCAGGAGG - Intergenic
955060477 3:55488323-55488345 CAGAAGGGCTGGGGGGTGGGAGG - Intronic
955260402 3:57383648-57383670 GAGTTGGGGTGGGGGGCGGGGGG + Intronic
955925279 3:63998196-63998218 CAGAAGGGGGGGGGGCCAGGTGG + Intronic
955971626 3:64443609-64443631 CGGTGGGGGTGGGGGGCGGGGGG + Intronic
958270543 3:91493631-91493653 AAGGATAGCTGGGGGGCAGGGGG + Intergenic
958586163 3:96091032-96091054 AAGTGGGGCATGGGGGCAGGGGG + Intergenic
958785670 3:98593882-98593904 GAGTAGGGCTGGGAGGCTGAGGG + Intergenic
961391651 3:126555839-126555861 CAGTGGGGCTGGGGAGCCTGCGG - Intronic
961479451 3:127170757-127170779 CAGGTGGGCTTGGGGGGAGGTGG + Intergenic
961594605 3:128006608-128006630 CAGAAGGGCTGAGGAGGAGGTGG + Intergenic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
962241966 3:133757351-133757373 CAGCCGGGCTGAGGGGCATGGGG - Intronic
963825158 3:149945352-149945374 CAGCAAGGCTGGGGGGTGGGGGG + Intronic
965329393 3:167351780-167351802 CTGCAGGGCTGGGGAGCAAGAGG + Intronic
965404278 3:168250126-168250148 GGGAAGGGATGGGGGGCAGGAGG + Intergenic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967035351 3:185645286-185645308 CAGAAGCCCTGGGGGGCGGGAGG + Exonic
967104197 3:186242262-186242284 GGGCAGGGCTGGAGGGCAGGAGG - Intronic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
968156876 3:196388297-196388319 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
968173798 3:196531333-196531355 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
968278649 3:197459344-197459366 GAGTAGGGATTGGGGTCAGGAGG + Intergenic
968582687 4:1402331-1402353 CTGCAGGGGTGGGGAGCAGGAGG + Intergenic
968920269 4:3518807-3518829 CAGGAGGGGTGGGGGGCAGGAGG + Intronic
968937855 4:3622548-3622570 ATGTGGGGCTGGGGGGCTGGTGG - Intergenic
969696513 4:8738135-8738157 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
970141644 4:12989332-12989354 CGGCGGGGATGGGGGGCAGGGGG + Intergenic
970386315 4:15560411-15560433 CAGTTGGGCTGGAGGACTGGGGG + Intronic
971351730 4:25862296-25862318 CAGGAGGGGTGGGGGGTTGGGGG + Intronic
971740748 4:30517394-30517416 CAGTAGGGCTTGTCGGGAGGTGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972164082 4:36261005-36261027 AAGTTTGGCTGGGAGGCAGGCGG - Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
972627392 4:40814021-40814043 CATGAGGGGTGGGGGACAGGGGG - Intronic
973595340 4:52482772-52482794 CTGTAGGGGTGAGGGGAAGGAGG - Intergenic
975063520 4:70035027-70035049 CACCAGGGATGGGGGGTAGGAGG + Intronic
975405211 4:73981419-73981441 CAGTTGGGCAGTGGGGCAGTGGG + Exonic
976569924 4:86595371-86595393 CGGTGGGGCTAGGGGGCCGGAGG - Intronic
976712133 4:88084110-88084132 CAGTAGGGATTGGGGCCAGTGGG - Intergenic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
978285573 4:107073405-107073427 TGGTAGGGGTGGGGGGGAGGGGG - Intronic
978790976 4:112663266-112663288 TAGTCGGGCTTGGTGGCAGGTGG - Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981914865 4:150022847-150022869 AAGTAGGGCTCTGTGGCAGGAGG + Intergenic
982136281 4:152277012-152277034 GAGTGGGGCTGGGGTGCGGGTGG + Intergenic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983883422 4:172957427-172957449 CAGCAGGGCAGCGGGGCAGTAGG + Intronic
984135240 4:175928628-175928650 CAGTAGGCCTGGCTGGCATGTGG + Intronic
984758246 4:183343158-183343180 CACGTGGGCTGGGGGTCAGGGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985033874 4:185819422-185819444 CAGAAGTGCTGGGTGGGAGGTGG - Intronic
985432413 4:189893940-189893962 CAGAGGGGGTGGGGGGGAGGCGG + Intergenic
985569602 5:637823-637845 GAGAAGGGCTGGGGAGCAGCAGG + Intronic
985629971 5:1009096-1009118 CGGTAGGGCGGGAGGGCGGGCGG + Intronic
985640792 5:1062673-1062695 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986348069 5:6852925-6852947 AAAGAGGGCTGGGGAGCAGGTGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
986613060 5:9589226-9589248 CAGAAGGGTGAGGGGGCAGGAGG - Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989601289 5:43203085-43203107 CGGTGGGGCTGGGGGGATGGTGG - Intronic
989619335 5:43368998-43369020 GAGGTGGGGTGGGGGGCAGGGGG + Intergenic
990442500 5:55860901-55860923 CAGCAGGGCTGGTTTGCAGGTGG + Intronic
990735055 5:58851319-58851341 CAGTTGGGCTGCGGTGGAGGAGG - Exonic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
995538881 5:113165043-113165065 CAGATGGGGTGGGGTGCAGGAGG - Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997200864 5:132009466-132009488 GAGAAAGGCTGGGGGCCAGGTGG + Intronic
997411847 5:133696715-133696737 AAGAAGGGCTGTGGGGAAGGAGG + Intergenic
997590260 5:135067937-135067959 CAGTAGGGCTTAGGGGCTGAGGG + Intronic
997720977 5:136078247-136078269 CGGTAGAGCTGGGGAGCTGGTGG + Intergenic
998093284 5:139383162-139383184 CAGGGGGGGTGGGGGGCTGGAGG - Intronic
998108189 5:139481736-139481758 CAGAAGGGCAGGAGGGCAAGGGG - Intronic
998136254 5:139676185-139676207 GAGGAGGGCTTGGGGGGAGGTGG - Intronic
998136295 5:139676297-139676319 GAGGAGGGCTTGGGGGGAGGAGG - Intronic
998136363 5:139676465-139676487 GAGGAGGGCTTGGGGGGAGGTGG - Intronic
998369868 5:141654030-141654052 CAGTGGGGCTGGGGGATTGGGGG + Exonic
998386514 5:141760217-141760239 CAGGGAGGCTGTGGGGCAGGGGG + Intergenic
998576570 5:143323770-143323792 CCGGAGGGATGGGGGGCAGGGGG + Intronic
998859456 5:146428407-146428429 CAGTAGGGCAGCGGGGCAAGAGG + Intergenic
999155939 5:149457619-149457641 CAGGAGGGCCTGGTGGCAGGTGG + Intergenic
999185734 5:149707192-149707214 CAGAAGGGCTTGGAGCCAGGTGG - Intergenic
999430232 5:151519531-151519553 CAGTAGTTCTGGGTGGCACGTGG + Intronic
1000037538 5:157460365-157460387 CGGCAGGGCTGGGGACCAGGCGG + Intronic
1000219876 5:159204380-159204402 AAGTAGTGGGGGGGGGCAGGGGG + Intronic
1000547276 5:162618931-162618953 GAGTAGGGTTGGGGTGTAGGAGG + Intergenic
1000896625 5:166862621-166862643 TAGTATGGATGGGTGGCAGGTGG + Intergenic
1001147146 5:169194919-169194941 CACTAGGGCAGAGGGGCATGGGG - Intronic
1001217761 5:169871776-169871798 AACTAGGGCTGGGGTGCATGGGG + Intronic
1001992785 5:176132466-176132488 CAGTAGGAGTGGGGTGCTGGTGG + Intergenic
1002196285 5:177503458-177503480 CAGTGGGGGCGGGGTGCAGGTGG - Intronic
1002372740 5:178767984-178768006 CTGTAGGGCTGTGAGTCAGGGGG + Intergenic
1002461431 5:179375845-179375867 CAGCAGGGGAGGGGGGAAGGGGG + Intergenic
1002587149 5:180256395-180256417 GGGTGGGGCAGGGGGGCAGGGGG + Intronic
1002684349 5:180996287-180996309 AAGAAGGGCTGGGGAGGAGGAGG - Intronic
1002706974 5:181168018-181168040 CAGTAGAGGTGGGGAGTAGGGGG - Intergenic
1002931716 6:1639495-1639517 TAGTACGGCTGGGGGCCAAGTGG + Intronic
1003072784 6:2957985-2958007 CAGTAGGCGTGGGAGGCACGTGG - Intronic
1003109499 6:3241736-3241758 CTGTTGGGGTGGGGGGCAAGGGG - Intronic
1003148974 6:3532617-3532639 CAAGAGGGCTGAGGGACAGGAGG - Intergenic
1003277419 6:4664510-4664532 AAGTGGGGCTGGGTGGGAGGCGG - Intergenic
1004822541 6:19383241-19383263 CAGAGGGGCAGGGGGGCAGGAGG - Intergenic
1004825114 6:19411516-19411538 CAGTAGTGGTGGGGAGCAGAGGG - Intergenic
1005504392 6:26457477-26457499 CAGGAGGGCTTGGGGGAAGCTGG - Intergenic
1005999768 6:30955820-30955842 CAGTAGGGCTGGGGCGCTGCGGG - Intergenic
1006342333 6:33453455-33453477 CAGAGGGGCGGGGGGGGAGGGGG - Exonic
1006502051 6:34465589-34465611 CAGTGGGGCGGTGGTGCAGGGGG + Intergenic
1006803108 6:36771820-36771842 CACTGGGGCTGGGGGGCGGGGGG + Intronic
1007076958 6:39074246-39074268 CAGTGGGGCAGGGGGGCCAGAGG + Intronic
1007104942 6:39277171-39277193 ATGTAAGGCTGGGGGCCAGGAGG - Intergenic
1007257455 6:40538783-40538805 GACTGGGGCTGGGGGGAAGGAGG + Intronic
1007486438 6:42184057-42184079 CAGGAGTTTTGGGGGGCAGGGGG - Intergenic
1007533550 6:42564290-42564312 CGGTAGCGCTGGGGAGGAGGAGG + Exonic
1007746234 6:44044388-44044410 CAGAATGGCTGGGGAGCGGGAGG + Intergenic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1007765076 6:44155223-44155245 CTGGAGACCTGGGGGGCAGGTGG + Exonic
1007820260 6:44555715-44555737 AAGGAGGGCCTGGGGGCAGGGGG + Intergenic
1008443246 6:51557057-51557079 AAGTAAGGTTGGGTGGCAGGTGG - Intergenic
1008539333 6:52533401-52533423 CTCTAGTGCTGGGGGGCACGTGG - Intronic
1008984601 6:57527712-57527734 AAGGATAGCTGGGGGGCAGGGGG - Intronic
1009172649 6:60420600-60420622 AAGGATAGCTGGGGGGCAGGGGG - Intergenic
1009905723 6:69867694-69867716 CAGAGGAGCTGGGGGACAGGCGG + Intronic
1009924968 6:70109471-70109493 AAGAAGGGTTGGGGGGCAAGTGG + Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010261635 6:73824068-73824090 CAGTAGGGCTAGGTTGGAGGTGG - Exonic
1011746672 6:90413455-90413477 CAGGAGGAGTGGGGGGCGGGGGG - Intergenic
1012251022 6:96980999-96981021 TGGTGGGGCGGGGGGGCAGGCGG + Intronic
1013265567 6:108494175-108494197 CACTGGGGCAGGGGAGCAGGGGG - Intronic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1013623076 6:111909230-111909252 CAGAAGGGCAGAGGTGCAGGAGG - Intergenic
1013836619 6:114342463-114342485 GAGCCGGGCGGGGGGGCAGGCGG + Exonic
1014013839 6:116506858-116506880 CTGTCAGGCTGGGGGGCTGGGGG + Intronic
1014134390 6:117871277-117871299 CGGAAGGAGTGGGGGGCAGGTGG + Intergenic
1014490215 6:122053382-122053404 AGGTGGGGCTGCGGGGCAGGAGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1016426477 6:143941483-143941505 CATGAGGGATGGGGGGCAGGGGG + Exonic
1016713968 6:147203631-147203653 CGCTCGGGCTGGGGGGCTGGGGG + Intergenic
1016844285 6:148555966-148555988 CAGTCAGGCTGAGGGCCAGGTGG - Intergenic
1016864072 6:148748177-148748199 CACTAGGGCCGGCGGGCAGGCGG - Intronic
1017446097 6:154509310-154509332 CAGTGGGGCTGGGGCGGTGGGGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017822434 6:158059377-158059399 CAGCTGGGCTGGGCGGCAGGTGG + Intronic
1018061613 6:160094055-160094077 AGGTAGGGCTGGTGGACAGGAGG - Intronic
1018197604 6:161368711-161368733 CAGAAGGGCGGGTGGGCAGCTGG - Intronic
1018811216 6:167299793-167299815 CCGCAGGGCTGGGGGCAAGGTGG + Intronic
1018812603 6:167308550-167308572 CAGGTGGGGTGGGGTGCAGGAGG + Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019444444 7:1063978-1064000 CTGCAGAGGTGGGGGGCAGGGGG + Intronic
1019489803 7:1306979-1307001 CAGTATGGCAGAGGGGCGGGGGG + Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019702572 7:2481024-2481046 CATCGGGGCTGTGGGGCAGGTGG - Intergenic
1020430780 7:8114282-8114304 TAGTGGGGTTGGGGTGCAGGTGG - Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1022501635 7:30885704-30885726 CAGCAGGGTTGGGGGGGGGGTGG - Intronic
1022649920 7:32265335-32265357 CACTATGGCTGGGGGACAGTTGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023748112 7:43341156-43341178 TCATAGGGTTGGGGGGCAGGGGG + Intronic
1024254724 7:47532067-47532089 CAGCAGGGATGGTGGGCGGGGGG - Intronic
1024803895 7:53113697-53113719 CAGCAGAGTTGGGGGGCAGAAGG - Intergenic
1024930388 7:54662789-54662811 GAGTAGGCTTGGGAGGCAGGGGG + Intergenic
1025085593 7:56020693-56020715 CTGCAGGGCGGGAGGGCAGGAGG + Intronic
1025093423 7:56081017-56081039 AGGGAGGGCTAGGGGGCAGGTGG - Exonic
1025142588 7:56478495-56478517 CAGCTGGGCTGTTGGGCAGGCGG + Intergenic
1025216436 7:57060547-57060569 AGGGAGGGCTGGGGGCCAGGTGG - Intergenic
1025627186 7:63232998-63233020 AGGGAGGGCTGGGGGGCAGGTGG - Intergenic
1025654946 7:63510183-63510205 AGGGAGGGCTGGGGGGCAGGTGG + Intergenic
1026020084 7:66699229-66699251 CAGGAGGAATGGGGGGCACGGGG + Intronic
1026830567 7:73607551-73607573 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1027235542 7:76295557-76295579 CAGCTGGGCAGGGGGGCATGTGG + Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1028074254 7:86492296-86492318 GAGTAGTGATGGTGGGCAGGTGG - Intergenic
1029221628 7:98995107-98995129 CAGGAAGGCAGGAGGGCAGGAGG - Intronic
1029425069 7:100489696-100489718 CATCAGGGGTGGGGGGCAGCTGG + Intronic
1029426253 7:100495808-100495830 CAGTAGGAGATGGGGGCAGGGGG + Intergenic
1029437207 7:100569986-100570008 CAGCAGGGGTGGGGGTGAGGTGG - Intergenic
1029567331 7:101347778-101347800 CTGGAGGGCTGGGTGGCAGTGGG - Intergenic
1030088311 7:105836131-105836153 CAGGAGGGCTGGGGGAGAAGGGG + Intronic
1031154584 7:118094898-118094920 GAGGAGGGCTGGCTGGCAGGTGG + Intergenic
1031732568 7:125316648-125316670 CAGTAGAGCTGGGGGACATGTGG + Intergenic
1032067786 7:128784533-128784555 CAAAAAGGCGGGGGGGCAGGGGG + Intergenic
1032085939 7:128884016-128884038 CAGCAGTGCTGGGGCCCAGGGGG + Exonic
1032324371 7:130913393-130913415 GAGCAGGGCTGGGGGTCAGAAGG - Intergenic
1032423536 7:131802242-131802264 CAGCAGCCCTGGGGGGCTGGTGG - Intergenic
1032640274 7:133758822-133758844 CTGTATCTCTGGGGGGCAGGGGG - Intronic
1032732815 7:134660602-134660624 CTGGAGGGCTGGGGAGGAGGAGG + Intronic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1034063161 7:148111233-148111255 GGGTAGGGGTGGGTGGCAGGAGG + Intronic
1034064640 7:148124497-148124519 CAGTAGGGCAGGTGCTCAGGAGG - Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034647856 7:152664540-152664562 GTGTAGGGTTGGGGGACAGGCGG - Intronic
1034839914 7:154386294-154386316 TGGTGGGGGTGGGGGGCAGGAGG - Intronic
1035021665 7:155804230-155804252 CAGGCGGGCAGGCGGGCAGGCGG - Intronic
1035051513 7:156001525-156001547 CAGTAGGGTTGGGAGTCAGTAGG + Intergenic
1035334834 7:158121184-158121206 CAGGGAGGCTGGGGTGCAGGGGG - Intronic
1035781837 8:2233748-2233770 GGGCAGGGCTGGGGAGCAGGAGG + Intergenic
1035810281 8:2485658-2485680 GGGCAGGGCTGGGGAGCAGGAGG - Intergenic
1035816993 8:2551806-2551828 CAGTAGTGATGGTGGGTAGGGGG + Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037696542 8:21228769-21228791 CAGGAGGGCTGGGGTGGAGTGGG + Intergenic
1037771233 8:21801296-21801318 CTGCAGGACTGGGAGGCAGGAGG + Intronic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038258775 8:25974740-25974762 CAGTAGGATGGGGGGGCAGGGGG - Intronic
1038261860 8:26002851-26002873 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261863 8:26002859-26002881 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261866 8:26002867-26002889 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261876 8:26002895-26002917 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261879 8:26002903-26002925 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038312157 8:26453070-26453092 CACTAGGTCTTGGGGGCTGGGGG - Intronic
1038524530 8:28261676-28261698 CTGTAGAGCTGTGGGCCAGGTGG - Intergenic
1038632762 8:29262454-29262476 AAGAAGGGCAGGGGGCCAGGCGG - Intronic
1039105350 8:33983685-33983707 CCGTAGGGCTGGGTGGATGGGGG - Intergenic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1039540382 8:38362248-38362270 CAGTAAGGCGGGGGGGGGGGGGG + Intronic
1039857155 8:41425379-41425401 CAGAAGGGGGGGGGGGGAGGGGG - Intergenic
1040604048 8:48912213-48912235 CAGTGGGGCTGGGAAGCAGCTGG - Intergenic
1040960509 8:53027223-53027245 CAGAAAGGCAGGGCGGCAGGAGG + Intergenic
1041123592 8:54611919-54611941 AAGAAAGGTTGGGGGGCAGGGGG - Intergenic
1041466918 8:58166269-58166291 CAGTGGAGGTGGGTGGCAGGAGG + Intronic
1041724400 8:61004708-61004730 CAGCAGGGCTGCGGGGGAGCTGG + Intergenic
1041775131 8:61514937-61514959 CAGGAAGGCAGGGAGGCAGGAGG + Intronic
1042949322 8:74184857-74184879 TATTAGGGGTGGGGTGCAGGGGG - Intergenic
1043052970 8:75405134-75405156 GAGTAGGGGTGGGGGGATGGGGG + Intergenic
1043165948 8:76902684-76902706 CAGTTGGGGTGGGGGCCAAGAGG - Intergenic
1043349537 8:79343575-79343597 CATTATGGCTGGGGGGGGGGGGG - Intergenic
1043521147 8:81046839-81046861 CCGGAGGGTTGGGGGGTAGGAGG - Intronic
1045408362 8:101890588-101890610 CAGAAGGGCAGAGGGGCAAGAGG - Intronic
1045911275 8:107413327-107413349 CAGGAAGGCTGGGGAGCAGAGGG - Intronic
1047348279 8:124049431-124049453 CCGTAGGTCTGGGGAGCAGTGGG - Intronic
1047367236 8:124222693-124222715 AAGTATGGCTGGGGGGAGGGCGG + Intergenic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1049182237 8:141228951-141228973 CAGGTGGGCTGTGGGGCGGGTGG - Intronic
1049324634 8:142015595-142015617 CAGGAGGCCTGAGGGTCAGGAGG + Intergenic
1049508928 8:143018268-143018290 CAGCAGGGCCGGGTGGAAGGAGG + Intronic
1049596166 8:143484305-143484327 CAGCCTGGCTGGGTGGCAGGGGG + Intronic
1049603313 8:143518057-143518079 CAGAAGGGCTGGGGGCCCTGTGG - Intronic
1049639988 8:143711169-143711191 CAACAGGGATGAGGGGCAGGAGG + Intronic
1049656227 8:143799451-143799473 CAGCAGGGCCGAGGGGGAGGTGG + Intronic
1049693306 8:143972173-143972195 CAGGAGGGCTGGAGCCCAGGTGG + Intronic
1049719656 8:144109889-144109911 CAGCAAGGCTGCGGCGCAGGGGG - Exonic
1049749248 8:144275682-144275704 CACCAGGGGTGGGGGGCAGGGGG + Intronic
1049749275 8:144275779-144275801 CAGGTTGGCTGGGGGCCAGGCGG - Intronic
1049822299 8:144643121-144643143 CAGGAAGGCTGGTGGGGAGGGGG - Intergenic
1050459737 9:5867393-5867415 TAGTAGGTCTAGGAGGCAGGGGG + Intergenic
1051725680 9:20086397-20086419 CATTAGGGCTTGGAGGCTGGGGG - Intergenic
1051858039 9:21592076-21592098 CAAGAGGGCTGGGAGGTAGGTGG + Intergenic
1052699717 9:31922712-31922734 CACCAGGGATGGGTGGCAGGTGG + Intergenic
1052799295 9:32952798-32952820 CAGTAGGGCCTGGTGGGAGGTGG - Intergenic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1052995998 9:34551896-34551918 CGGCAGGGCTGGGGGGCGGCAGG + Exonic
1052998794 9:34565942-34565964 CAGTTGGGGTGGGGGGCTGCGGG + Intronic
1053054819 9:34988127-34988149 AAGTGGGGTTGGGGGCCAGGAGG - Intergenic
1055316734 9:75041530-75041552 GAGCAGGCCTGTGGGGCAGGAGG - Intergenic
1055539784 9:77291299-77291321 AAGTGGGGCTGGGGGGTTGGAGG - Intronic
1055667581 9:78567903-78567925 CACTAGGGCTGTGGGGAATGTGG + Intergenic
1057176794 9:93006113-93006135 CCGTAGGGCTGGTGAGCACGTGG + Exonic
1057275314 9:93673199-93673221 CAGAGTGGCTGGGGTGCAGGAGG + Intronic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057532002 9:95857179-95857201 CAGAAGTGATGGGGGGGAGGAGG + Intergenic
1057674403 9:97127331-97127353 AAGGAGGGCCTGGGGGCAGGAGG + Intergenic
1057793219 9:98137704-98137726 CAGGAGGGTTGGGGAGGAGGTGG + Intronic
1057995952 9:99821912-99821934 CTGGAGGGGTGGGGGGCGGGAGG - Exonic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059977814 9:119736766-119736788 CAGGAGGGGAGGGGGGCAGATGG + Intergenic
1060147430 9:121265046-121265068 CACTAGGGCAGGGGTGCAGCTGG - Intronic
1060198509 9:121638497-121638519 CAGGAGGGCTGTGGAGGAGGCGG + Intronic
1060304876 9:122402398-122402420 CAGTAGGGATGGGGGAGTGGAGG + Intergenic
1060402321 9:123356097-123356119 CAGGAGGCCTGGGTGGGAGGAGG + Intergenic
1060464171 9:123887677-123887699 AAGCAGGGCAGTGGGGCAGGAGG + Intronic
1060527515 9:124328800-124328822 CAGCGGGGCTGGCGGGGAGGGGG + Intronic
1060551498 9:124487623-124487645 CCGCAGGGCGGTGGGGCAGGTGG + Intronic
1060748244 9:126151876-126151898 CAGGGAGGCTGTGGGGCAGGGGG - Intergenic
1060813838 9:126624615-126624637 CCCTCGGGCTGGGGCGCAGGAGG - Intronic
1060838765 9:126777993-126778015 TGGTTGGGCTGGGAGGCAGGTGG + Intergenic
1060941587 9:127545868-127545890 CAGGCGGGGTGGGGGGCAGGAGG - Intronic
1061026691 9:128054435-128054457 CAGCAGGGCCTGGAGGCAGGAGG + Intergenic
1061043660 9:128153211-128153233 CAGCAGTGCTGGGGGGCAGGGGG - Intronic
1061219655 9:129242828-129242850 CAGTCTGGCTGGGGTGCAGGAGG + Intergenic
1061228163 9:129293224-129293246 CAGGTCGGGTGGGGGGCAGGGGG - Intergenic
1061233214 9:129326940-129326962 CAGCAGGGCTGGGTGGGAGTGGG + Intergenic
1061295339 9:129673963-129673985 ACGTGGGGCAGGGGGGCAGGTGG + Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061420292 9:130469892-130469914 CAGTGGGGCTGAGGGGCTGAAGG + Intronic
1061498387 9:130988908-130988930 TAGTACGGTTGGGGGGCAGGAGG + Intergenic
1061680019 9:132238346-132238368 ACGTAGGGGTGGGGTGCAGGAGG + Intronic
1061897680 9:133656934-133656956 CAGCGGGGCTGGGGAGGAGGTGG + Intronic
1062003006 9:134226206-134226228 CAGGGGGGCTGGGAGGCAGGGGG + Intergenic
1062038065 9:134391500-134391522 CAGGCGGGCTGTGGGGCAGGCGG + Intronic
1062061951 9:134501715-134501737 CAGCAGGGGTGAGGGGCGGGTGG - Intergenic
1062070153 9:134551061-134551083 CAGGAGGGAAGGGGGCCAGGTGG + Intergenic
1062245345 9:135563211-135563233 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245423 9:135563507-135563529 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245426 9:135563515-135563537 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245429 9:135563523-135563545 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380732 9:136285428-136285450 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380735 9:136285436-136285458 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380738 9:136285444-136285466 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062380744 9:136285460-136285482 CAGGCGGGCAGGTGGGCAGGTGG + Intronic
1062380747 9:136285468-136285490 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380750 9:136285476-136285498 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380753 9:136285484-136285506 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062386003 9:136311816-136311838 CAGCAGGGCTGGGGGGCCGGGGG - Intergenic
1062421272 9:136483766-136483788 CCGTTGGGCTGGGAGGCTGGAGG + Exonic
1062480292 9:136747901-136747923 CTGTAGGGCTGGAAGGCTGGAGG - Intronic
1062484984 9:136770190-136770212 CAGGCGGGGTGAGGGGCAGGCGG - Intergenic
1062484991 9:136770206-136770228 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062484998 9:136770222-136770244 CAGGCGGGGTGAGGGGCAGGCGG - Intergenic
1062485005 9:136770238-136770260 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485012 9:136770254-136770276 CAGGCGGGGTGAGGGGCAGGCGG - Intergenic
1062485019 9:136770270-136770292 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485038 9:136770316-136770338 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485057 9:136770362-136770384 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485070 9:136770393-136770415 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485077 9:136770409-136770431 CAGGCGGGGTGAGGGGCAGGCGG - Intergenic
1062485090 9:136770440-136770462 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485097 9:136770456-136770478 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485110 9:136770487-136770509 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062485117 9:136770503-136770525 CAGGCGGGGTGAGGGGCAGGCGG - Intergenic
1062485136 9:136770549-136770571 CAGGCGGGGTGCGGGGCAGGCGG - Intergenic
1062532755 9:137009109-137009131 CTGTAGGGCTGGGAGGCTGGGGG - Intronic
1062588631 9:137263237-137263259 CAGGAGGGTAGGGGGGAAGGAGG - Intronic
1062588692 9:137263393-137263415 CAGGAGGGCGGAGGGGGAGGAGG - Intronic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1062655870 9:137604654-137604676 CAGAAGGGTCGGGGGCCAGGTGG - Intergenic
1185492196 X:526244-526266 CAGCAGGGGTGGGGGGACGGCGG + Intergenic
1185711851 X:2310480-2310502 CAGTAGGTCTTAGGGGCAGATGG - Intronic
1186466255 X:9786383-9786405 CCGGAGGGCTGGCGGGGAGGGGG - Intergenic
1187056276 X:15744074-15744096 CTCTAGGGCTAGGGGGCAGGAGG - Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187900725 X:24025213-24025235 GAAAAGGGCTGGGGGGCAGCAGG + Intronic
1187922507 X:24218997-24219019 TAGTAGGTCTTGGGGCCAGGCGG + Intergenic
1187984800 X:24798397-24798419 GAGTAGGGCTGAGGAGGAGGAGG - Intronic
1188004847 X:25010207-25010229 GAGGAGGGCTGGGGGCCAGTGGG - Intronic
1189331467 X:40147050-40147072 CGCTAGGGCTGGGGGCCAGCGGG - Intronic
1189378526 X:40484609-40484631 CAGCCAGGCTGGGGGCCAGGAGG + Intergenic
1189612689 X:42753981-42754003 GAGAAGGGGAGGGGGGCAGGAGG + Intergenic
1189926466 X:45960086-45960108 CAGCAGGGGTGGGGTGCTGGTGG - Intergenic
1190245384 X:48687338-48687360 GAGAAGGGCTGGTGGGTAGGTGG + Intronic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1190970278 X:55341851-55341873 CAGTGGGGCTTTGGGGCAGAGGG - Intergenic
1191254904 X:58275446-58275468 CAGTAGGGCATGGGGGCTGCTGG + Intergenic
1191641636 X:63433598-63433620 GAGTGGGGCTGGGGGGCGGGTGG + Intergenic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1192436391 X:71145944-71145966 GAGTAGGGAGGTGGGGCAGGAGG - Intronic
1192859247 X:75048285-75048307 GGGTAGGGCTGGGTGGCAGAAGG + Intergenic
1194073005 X:89350772-89350794 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1195968262 X:110448685-110448707 CAGGCTGGCTGGCGGGCAGGGGG + Intronic
1196517848 X:116634053-116634075 CTGTCGGGGTGGGGGGCAAGGGG + Intergenic
1197871839 X:131068677-131068699 CAGTGGGGCTCGGGGGGTGGGGG - Intronic
1198671545 X:139086285-139086307 CAGTATGTTTGGGGGGCAGTAGG - Intronic
1199086501 X:143635021-143635043 CAGGCGGGCCGGCGGGCAGGCGG + Intronic
1199767941 X:150954144-150954166 CAGGAGGGCAGGAGAGCAGGAGG - Intergenic
1200002641 X:153069926-153069948 GAGAAGCGGTGGGGGGCAGGGGG + Intergenic
1200005082 X:153080083-153080105 GAGAAGCGGTGGGGGGCAGGGGG - Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200727245 Y:6686512-6686534 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1200728397 Y:6702287-6702309 CAGAAGGACTGGCAGGCAGGAGG + Intergenic