ID: 1084021316

View in Genome Browser
Species Human (GRCh38)
Location 11:66419991-66420013
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021316_1084021331 18 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021316_1084021330 17 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021330 11:66420031-66420053 TTCCTGTCCTAATATGGAGCTGG No data
1084021316_1084021334 28 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021334 11:66420042-66420064 ATATGGAGCTGGGATTCCCCCGG No data
1084021316_1084021325 -7 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021325 11:66420007-66420029 GCAGCCGCGGCAGCCGCCGGAGG No data
1084021316_1084021323 -10 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG No data
1084021316_1084021329 11 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021329 11:66420025-66420047 GGAGGATTCCTGTCCTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021316 Original CRISPR CGGCTGCGGCGGGCGGGGCC TGG (reversed) Intergenic