ID: 1084021318

View in Genome Browser
Species Human (GRCh38)
Location 11:66419996-66420018
Sequence TGCCGCGGCTGCGGCGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021318_1084021330 12 Left 1084021318 11:66419996-66420018 CCCCGCCCGCCGCAGCCGCGGCA No data
Right 1084021330 11:66420031-66420053 TTCCTGTCCTAATATGGAGCTGG No data
1084021318_1084021334 23 Left 1084021318 11:66419996-66420018 CCCCGCCCGCCGCAGCCGCGGCA No data
Right 1084021334 11:66420042-66420064 ATATGGAGCTGGGATTCCCCCGG No data
1084021318_1084021331 13 Left 1084021318 11:66419996-66420018 CCCCGCCCGCCGCAGCCGCGGCA No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021318_1084021329 6 Left 1084021318 11:66419996-66420018 CCCCGCCCGCCGCAGCCGCGGCA No data
Right 1084021329 11:66420025-66420047 GGAGGATTCCTGTCCTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021318 Original CRISPR TGCCGCGGCTGCGGCGGGCG GGG (reversed) Intergenic