ID: 1084021323

View in Genome Browser
Species Human (GRCh38)
Location 11:66420004-66420026
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021313_1084021323 13 Left 1084021313 11:66419968-66419990 CCTCCGGAGCGGTGCGGAGGCAG No data
Right 1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG No data
1084021312_1084021323 14 Left 1084021312 11:66419967-66419989 CCCTCCGGAGCGGTGCGGAGGCA No data
Right 1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG No data
1084021314_1084021323 10 Left 1084021314 11:66419971-66419993 CCGGAGCGGTGCGGAGGCAGCCA No data
Right 1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG No data
1084021316_1084021323 -10 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021323 Original CRISPR GCCGCAGCCGCGGCAGCCGC CGG Intergenic