ID: 1084021325

View in Genome Browser
Species Human (GRCh38)
Location 11:66420007-66420029
Sequence GCAGCCGCGGCAGCCGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021316_1084021325 -7 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021325 11:66420007-66420029 GCAGCCGCGGCAGCCGCCGGAGG No data
1084021313_1084021325 16 Left 1084021313 11:66419968-66419990 CCTCCGGAGCGGTGCGGAGGCAG No data
Right 1084021325 11:66420007-66420029 GCAGCCGCGGCAGCCGCCGGAGG No data
1084021312_1084021325 17 Left 1084021312 11:66419967-66419989 CCCTCCGGAGCGGTGCGGAGGCA No data
Right 1084021325 11:66420007-66420029 GCAGCCGCGGCAGCCGCCGGAGG No data
1084021314_1084021325 13 Left 1084021314 11:66419971-66419993 CCGGAGCGGTGCGGAGGCAGCCA No data
Right 1084021325 11:66420007-66420029 GCAGCCGCGGCAGCCGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021325 Original CRISPR GCAGCCGCGGCAGCCGCCGG AGG Intergenic