ID: 1084021326

View in Genome Browser
Species Human (GRCh38)
Location 11:66420011-66420033
Sequence GAATCCTCCGGCGGCTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021326_1084021329 -9 Left 1084021326 11:66420011-66420033 CCGCGGCAGCCGCCGGAGGATTC No data
Right 1084021329 11:66420025-66420047 GGAGGATTCCTGTCCTAATATGG No data
1084021326_1084021334 8 Left 1084021326 11:66420011-66420033 CCGCGGCAGCCGCCGGAGGATTC No data
Right 1084021334 11:66420042-66420064 ATATGGAGCTGGGATTCCCCCGG No data
1084021326_1084021330 -3 Left 1084021326 11:66420011-66420033 CCGCGGCAGCCGCCGGAGGATTC No data
Right 1084021330 11:66420031-66420053 TTCCTGTCCTAATATGGAGCTGG No data
1084021326_1084021331 -2 Left 1084021326 11:66420011-66420033 CCGCGGCAGCCGCCGGAGGATTC No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021326_1084021338 26 Left 1084021326 11:66420011-66420033 CCGCGGCAGCCGCCGGAGGATTC No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021326 Original CRISPR GAATCCTCCGGCGGCTGCCG CGG (reversed) Intergenic