ID: 1084021327

View in Genome Browser
Species Human (GRCh38)
Location 11:66420020-66420042
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021327_1084021344 25 Left 1084021327 11:66420020-66420042 CCGCCGGAGGATTCCTGTCCTAA No data
Right 1084021344 11:66420068-66420090 CGCCCCCGCCCCCGGCCCGCGGG No data
1084021327_1084021343 24 Left 1084021327 11:66420020-66420042 CCGCCGGAGGATTCCTGTCCTAA No data
Right 1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG No data
1084021327_1084021334 -1 Left 1084021327 11:66420020-66420042 CCGCCGGAGGATTCCTGTCCTAA No data
Right 1084021334 11:66420042-66420064 ATATGGAGCTGGGATTCCCCCGG No data
1084021327_1084021338 17 Left 1084021327 11:66420020-66420042 CCGCCGGAGGATTCCTGTCCTAA No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data
1084021327_1084021345 26 Left 1084021327 11:66420020-66420042 CCGCCGGAGGATTCCTGTCCTAA No data
Right 1084021345 11:66420069-66420091 GCCCCCGCCCCCGGCCCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021327 Original CRISPR TTAGGACAGGAATCCTCCGG CGG (reversed) Intergenic