ID: 1084021331

View in Genome Browser
Species Human (GRCh38)
Location 11:66420032-66420054
Sequence TCCTGTCCTAATATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021318_1084021331 13 Left 1084021318 11:66419996-66420018 CCCCGCCCGCCGCAGCCGCGGCA No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021322_1084021331 7 Left 1084021322 11:66420002-66420024 CCGCCGCAGCCGCGGCAGCCGCC No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021316_1084021331 18 Left 1084021316 11:66419991-66420013 CCAGGCCCCGCCCGCCGCAGCCG No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021319_1084021331 12 Left 1084021319 11:66419997-66420019 CCCGCCCGCCGCAGCCGCGGCAG No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021320_1084021331 11 Left 1084021320 11:66419998-66420020 CCGCCCGCCGCAGCCGCGGCAGC No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021324_1084021331 4 Left 1084021324 11:66420005-66420027 CCGCAGCCGCGGCAGCCGCCGGA No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021321_1084021331 8 Left 1084021321 11:66420001-66420023 CCCGCCGCAGCCGCGGCAGCCGC No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data
1084021326_1084021331 -2 Left 1084021326 11:66420011-66420033 CCGCGGCAGCCGCCGGAGGATTC No data
Right 1084021331 11:66420032-66420054 TCCTGTCCTAATATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021331 Original CRISPR TCCTGTCCTAATATGGAGCT GGG Intergenic