ID: 1084021333

View in Genome Browser
Species Human (GRCh38)
Location 11:66420038-66420060
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021333_1084021353 17 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data
1084021333_1084021355 21 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021333_1084021358 28 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021358 11:66420089-66420111 GGGAGACAGAGGCTGGCAGCAGG No data
1084021333_1084021343 6 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG No data
1084021333_1084021359 29 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021359 11:66420090-66420112 GGAGACAGAGGCTGGCAGCAGGG No data
1084021333_1084021345 8 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021345 11:66420069-66420091 GCCCCCGCCCCCGGCCCGCGGGG No data
1084021333_1084021344 7 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021344 11:66420068-66420090 CGCCCCCGCCCCCGGCCCGCGGG No data
1084021333_1084021338 -1 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021333 Original CRISPR GGGAATCCCAGCTCCATATT AGG (reversed) Intergenic