ID: 1084021338

View in Genome Browser
Species Human (GRCh38)
Location 11:66420060-66420082
Sequence CCCGGCCCCGCCCCCGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021326_1084021338 26 Left 1084021326 11:66420011-66420033 CCGCGGCAGCCGCCGGAGGATTC No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data
1084021328_1084021338 14 Left 1084021328 11:66420023-66420045 CCGGAGGATTCCTGTCCTAATAT No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data
1084021327_1084021338 17 Left 1084021327 11:66420020-66420042 CCGCCGGAGGATTCCTGTCCTAA No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data
1084021332_1084021338 4 Left 1084021332 11:66420033-66420055 CCTGTCCTAATATGGAGCTGGGA No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data
1084021333_1084021338 -1 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021338 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021338 Original CRISPR CCCGGCCCCGCCCCCGCCCC CGG Intergenic