ID: 1084021343

View in Genome Browser
Species Human (GRCh38)
Location 11:66420067-66420089
Sequence CCGCCCCCGCCCCCGGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021328_1084021343 21 Left 1084021328 11:66420023-66420045 CCGGAGGATTCCTGTCCTAATAT No data
Right 1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG No data
1084021332_1084021343 11 Left 1084021332 11:66420033-66420055 CCTGTCCTAATATGGAGCTGGGA No data
Right 1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG No data
1084021327_1084021343 24 Left 1084021327 11:66420020-66420042 CCGCCGGAGGATTCCTGTCCTAA No data
Right 1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG No data
1084021333_1084021343 6 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021343 Original CRISPR CCGCCCCCGCCCCCGGCCCG CGG Intergenic
No off target data available for this crispr