ID: 1084021353

View in Genome Browser
Species Human (GRCh38)
Location 11:66420078-66420100
Sequence CCCGGCCCGCGGGGAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021335_1084021353 -3 Left 1084021335 11:66420058-66420080 CCCCCGGCCCCGCCCCCGCCCCC No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data
1084021337_1084021353 -5 Left 1084021337 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data
1084021339_1084021353 -6 Left 1084021339 11:66420061-66420083 CCGGCCCCGCCCCCGCCCCCGGC No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data
1084021336_1084021353 -4 Left 1084021336 11:66420059-66420081 CCCCGGCCCCGCCCCCGCCCCCG No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data
1084021340_1084021353 -10 Left 1084021340 11:66420065-66420087 CCCCGCCCCCGCCCCCGGCCCGC No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data
1084021332_1084021353 22 Left 1084021332 11:66420033-66420055 CCTGTCCTAATATGGAGCTGGGA No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data
1084021333_1084021353 17 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021353 11:66420078-66420100 CCCGGCCCGCGGGGAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021353 Original CRISPR CCCGGCCCGCGGGGAGACAG AGG Intergenic