ID: 1084021355

View in Genome Browser
Species Human (GRCh38)
Location 11:66420082-66420104
Sequence GCCCGCGGGGAGACAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084021339_1084021355 -2 Left 1084021339 11:66420061-66420083 CCGGCCCCGCCCCCGCCCCCGGC No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021341_1084021355 -7 Left 1084021341 11:66420066-66420088 CCCGCCCCCGCCCCCGGCCCGCG No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021342_1084021355 -8 Left 1084021342 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021335_1084021355 1 Left 1084021335 11:66420058-66420080 CCCCCGGCCCCGCCCCCGCCCCC No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021337_1084021355 -1 Left 1084021337 11:66420060-66420082 CCCGGCCCCGCCCCCGCCCCCGG No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021340_1084021355 -6 Left 1084021340 11:66420065-66420087 CCCCGCCCCCGCCCCCGGCCCGC No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021333_1084021355 21 Left 1084021333 11:66420038-66420060 CCTAATATGGAGCTGGGATTCCC No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021332_1084021355 26 Left 1084021332 11:66420033-66420055 CCTGTCCTAATATGGAGCTGGGA No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data
1084021336_1084021355 0 Left 1084021336 11:66420059-66420081 CCCCGGCCCCGCCCCCGCCCCCG No data
Right 1084021355 11:66420082-66420104 GCCCGCGGGGAGACAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084021355 Original CRISPR GCCCGCGGGGAGACAGAGGC TGG Intergenic