ID: 1084025616

View in Genome Browser
Species Human (GRCh38)
Location 11:66447030-66447052
Sequence CTACCAGGAAGCAACTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084025613_1084025616 21 Left 1084025613 11:66446986-66447008 CCGGTCAATGGAAACACAGTTTT 0: 1
1: 0
2: 0
3: 27
4: 324
Right 1084025616 11:66447030-66447052 CTACCAGGAAGCAACTCCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1084025612_1084025616 27 Left 1084025612 11:66446980-66447002 CCACTTCCGGTCAATGGAAACAC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1084025616 11:66447030-66447052 CTACCAGGAAGCAACTCCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084025616 Original CRISPR CTACCAGGAAGCAACTCCCC AGG Intronic
900416815 1:2539149-2539171 CTACTCTGCAGCAACTCCCCAGG + Intergenic
901334997 1:8441433-8441455 CTACCAGGCAGCACTGCCCCAGG + Intronic
901642711 1:10701177-10701199 CTGCCAGGGAGCAGCTGCCCAGG - Intronic
904133977 1:28296818-28296840 CCGCCAGGCAGCATCTCCCCTGG + Intergenic
906365674 1:45207102-45207124 CCACCAGGATGCAACCCCCGTGG - Intronic
906703904 1:47880683-47880705 CTCCCATGGAGCATCTCCCCAGG - Intronic
912405808 1:109436655-109436677 TTACCATGAAGCAAGTCCCCTGG - Intergenic
915948650 1:160172825-160172847 CTACCTGGAAACCACTGCCCAGG - Intronic
916175361 1:162033584-162033606 TTTCCAGGCAGCAACTCCCTGGG - Intergenic
916338502 1:163700505-163700527 CTACAAAGAAGTAACTGCCCTGG - Intergenic
916891497 1:169116297-169116319 CTACCAGGAAGCAAGCCAGCTGG - Intronic
917038548 1:170776954-170776976 CTGCCAAGAGGCAAGTCCCCAGG - Intergenic
917491209 1:175500261-175500283 CTTCTAGCAAGCAACTCCCTGGG - Intronic
917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG + Exonic
1065177958 10:23096507-23096529 CGCCCAGGAAGCCAATCCCCTGG - Intronic
1074200874 10:111234079-111234101 GTACCAGGAAGAAAATCCACTGG - Intergenic
1075663576 10:124215137-124215159 CTTCCAGGCAGCAAATCCACAGG - Intergenic
1075923851 10:126235205-126235227 CCATCAGGAAGCCACCCCCCAGG + Intronic
1076234785 10:128855140-128855162 CTACCAGGAGGCAGATCCCTCGG + Intergenic
1076382588 10:130035551-130035573 CATTCAGGCAGCAACTCCCCAGG + Intergenic
1076801820 10:132834496-132834518 CTCCCAGGAAGCAATTCTTCTGG - Intronic
1078657600 11:13256192-13256214 CCACCGGGAACAAACTCCCCAGG - Intergenic
1084025616 11:66447030-66447052 CTACCAGGAAGCAACTCCCCAGG + Intronic
1085178378 11:74510845-74510867 CTGCCAGGCAGCATATCCCCTGG + Intronic
1096474761 12:51901576-51901598 CAATAAGGAAGCCACTCCCCGGG + Intergenic
1097865805 12:64558361-64558383 CCACCAGAAAGCATCTCCCATGG - Intergenic
1100140451 12:91612532-91612554 GTACCACAAAGCCACTCCCCTGG + Intergenic
1102399225 12:112614108-112614130 CTAGAAGGAACCAGCTCCCCTGG + Intronic
1102813577 12:115844315-115844337 CTCCCTGGAACCACCTCCCCAGG + Intergenic
1104943430 12:132405259-132405281 CAATCAGGGAGCAGCTCCCCAGG - Intergenic
1111731729 13:92085497-92085519 CTACCACAAAACCACTCCCCTGG - Intronic
1112504668 13:99968755-99968777 TTTCCAGGAAGAAACTTCCCAGG - Intronic
1113360433 13:109626068-109626090 CTACCAGGCACCTACACCCCAGG - Intergenic
1114592998 14:23885819-23885841 CTACCAGAATGCCACTGCCCTGG - Intergenic
1115420264 14:33185865-33185887 CTACCAGTAAGCAATCCCCAAGG + Intronic
1117953330 14:61104003-61104025 CTGCCAGGAAGAAAAACCCCAGG - Intergenic
1118723658 14:68611326-68611348 GGACAAGGAAGCAACTTCCCTGG - Intronic
1119434016 14:74586228-74586250 CAAGCAGGAAGCCACTCTCCTGG + Intronic
1121034119 14:90685081-90685103 CTGCCAGGAAGCTGCACCCCAGG - Intronic
1122172628 14:99889449-99889471 CCACCAGGAGGCAATTCCACAGG - Intronic
1122518520 14:102326098-102326120 CCACCAGGCAGGAATTCCCCCGG - Exonic
1122856969 14:104564501-104564523 CAATCAGGAAGCGCCTCCCCCGG - Intronic
1123637783 15:22376033-22376055 CCACCAGGAGGCCCCTCCCCTGG - Intergenic
1126598535 15:50405757-50405779 CTACCAGGAAACATCTTTCCTGG - Intergenic
1130227131 15:82067746-82067768 CTACCAGGAAGCATATCTGCAGG - Intergenic
1130744635 15:86637998-86638020 CTATCAGGAAGCAAATACACAGG - Intronic
1136583026 16:31165702-31165724 CCACCAGGAAGGAACTCTTCTGG - Intergenic
1139383114 16:66547208-66547230 CAACCAACCAGCAACTCCCCTGG + Intronic
1139545125 16:67646419-67646441 CTACCAGGAAGCTATTCCGGAGG + Exonic
1146278458 17:31530109-31530131 CTCCCAGGATGCCAGTCCCCTGG + Intronic
1146475936 17:33162807-33162829 CTTCCTGGTAGCAGCTCCCCTGG + Intronic
1151444799 17:74156236-74156258 CTCCCAGGAGGCAGCTCCCCTGG + Intergenic
1151913446 17:77100159-77100181 CTACCAGGAAGAAAGTCAACAGG - Intronic
1157696614 18:49728468-49728490 TTACCAGGAAATAACTCTCCAGG - Intergenic
1163799623 19:19356668-19356690 CTGCCAGGAAGAAAGTCCCTGGG - Exonic
1164703587 19:30303453-30303475 CTTTCAGGAAACAACCCCCCAGG - Intronic
1165892123 19:39119525-39119547 CCACCTGGAAGCAACTCTGCTGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
925459750 2:4050226-4050248 CTACCAAGAAGCCACTCCCTTGG + Intergenic
934049855 2:88200918-88200940 CTTCCAGGAGGCATCTCCTCCGG - Intergenic
935223363 2:101033678-101033700 TTACCAGGCAGCATTTCCCCAGG + Exonic
937625288 2:124036512-124036534 CTATCAGAAAGCATCTGCCCTGG - Intronic
937758012 2:125564565-125564587 CCAGCAGGCAGCAACTCCACTGG + Intergenic
939902365 2:147865998-147866020 CCACCAGGGAGCAACTCACCAGG - Intronic
946480836 2:220055182-220055204 GTAACAGGAAGCAACTTTCCAGG - Intergenic
947855847 2:233324011-233324033 CTACCTGGAAGGCTCTCCCCTGG - Intronic
948804568 2:240447902-240447924 CAACCAGGAAGCAGCTGCGCCGG - Intronic
1168832706 20:855548-855570 CTCCCAGGAACGAACTCCCCTGG - Intronic
1170587917 20:17749588-17749610 CTAACATGAAGCCAGTCCCCAGG - Intergenic
1173354082 20:42270458-42270480 CCACAAGGAAGCCAGTCCCCAGG + Intronic
1174479066 20:50818279-50818301 CTTCCAGGCAGCCACTCACCAGG - Exonic
1183075933 22:35426707-35426729 CTTCCTGGGAGCACCTCCCCGGG - Intergenic
1183514442 22:38255909-38255931 TCACCTGGAAGGAACTCCCCTGG - Intronic
1184042250 22:41951177-41951199 CTTCCAGGAACCACCTCCCTAGG - Intergenic
1184595098 22:45509169-45509191 CTTCCAGGACGCATCTCCCCTGG - Intronic
1185246277 22:49774969-49774991 GAACCAGGAAGCACCTGCCCGGG + Intronic
952301340 3:32106792-32106814 CTTCCAGGAAGCGCCTCTCCCGG + Intronic
955214983 3:56977690-56977712 CTGCCAGGCACCAAGTCCCCTGG - Intronic
955347163 3:58169756-58169778 CCACCAGGAAGGAACTCTTCTGG - Exonic
956063994 3:65377879-65377901 CCAGCAGGAAGCAACACACCAGG + Intronic
963511223 3:146251211-146251233 CTTCCAGGAAGACGCTCCCCCGG - Intergenic
964642794 3:158928040-158928062 CTACCAGGAGGCAACTCTCTGGG - Intergenic
967983907 3:195081386-195081408 CTTCCAGGAAGCCTGTCCCCGGG - Intronic
968649562 4:1755112-1755134 CCACCATGTAGCAACACCCCTGG + Intergenic
968670984 4:1851450-1851472 TTAACAGGAGGCAACTCTCCTGG + Intronic
970876742 4:20879388-20879410 GTACCAGGAAGCAACACACATGG - Intronic
975723465 4:77270196-77270218 CTTCCAGGAAGCAGATCCTCAGG + Intronic
983178873 4:164623672-164623694 CTACCTGCAAGCAACACCCATGG + Intergenic
985768293 5:1793356-1793378 CTGCCAGGAGGCAGCTCCCCTGG - Intergenic
985827896 5:2206210-2206232 CTACCAGGGAGCAATTCAGCGGG + Intergenic
986111656 5:4725003-4725025 CTCCCAGGAAGGAAATCTCCTGG + Intergenic
986735190 5:10662945-10662967 ATACCAGGGAGCAACTCCTGTGG - Intergenic
989668477 5:43886007-43886029 TTATCAGGAAGCAAATACCCAGG + Intergenic
989977460 5:50603070-50603092 GTACCAGGCAGCCACTCCCTAGG + Intergenic
991181176 5:63752832-63752854 ATATTAGGAAGCAACTCCCTAGG + Intergenic
992459042 5:76943278-76943300 CTACCAGGAAGCCACTATGCTGG - Intergenic
992747200 5:79831473-79831495 TGACCTGGAGGCAACTCCCCAGG - Intergenic
995452605 5:112318958-112318980 TTACCATGAAGCACGTCCCCAGG + Intronic
997839320 5:137224740-137224762 ATAACAAGAAGAAACTCCCCAGG + Intronic
999728711 5:154459159-154459181 CTTCCATGAAGCAACTGCTCTGG - Exonic
999851590 5:155546196-155546218 CTACCAAGTAGCTACTCTCCAGG - Intergenic
1001668863 5:173457172-173457194 CAAAGAGGAAGCAACTCCCCAGG + Intergenic
1001916094 5:175561378-175561400 CTAGGAAGAAGCAACTGCCCGGG + Intergenic
1003288218 6:4753583-4753605 CTACCAGGAGGCAAATACCTGGG - Intronic
1003298074 6:4851989-4852011 CCACCAAGAAGCAACTGGCCTGG - Intronic
1006405953 6:33844925-33844947 CTAACCTGAAGCAACTGCCCTGG - Intergenic
1006416630 6:33908278-33908300 CTAACATGAAGCAATTCCACTGG + Intergenic
1007477031 6:42125697-42125719 CTCCCAGGAAGTATTTCCCCAGG + Intronic
1008591943 6:53002729-53002751 TTACCAGCAAGCAACTTCCCTGG - Exonic
1017971368 6:159315276-159315298 CTGCCTGGAAGGAGCTCCCCAGG + Intergenic
1019609819 7:1930733-1930755 CCACCAGGAAGCAAGTCCCAGGG - Intronic
1019631731 7:2053197-2053219 CTACCAGGTAGCAGATCCCGAGG - Intronic
1019792424 7:3024870-3024892 AGACCAGGAAGCAGCTACCCAGG + Intronic
1023163869 7:37324054-37324076 CTTCCTGGAAGCACCTTCCCAGG + Intronic
1026767107 7:73167030-73167052 ATCCCAGGAAGCCACTCACCAGG - Intergenic
1027043576 7:74976741-74976763 ATCCCAGGAAGCCACTCACCAGG - Intronic
1027080071 7:75225618-75225640 ATCCCAGGAAGCCACTCACCAGG + Intergenic
1029389292 7:100264223-100264245 ATCCCAGGAAGCCACTCACCAGG + Intronic
1033582100 7:142747625-142747647 CTACCAGGAAGAAAAGCACCAGG + Intergenic
1034436473 7:151064922-151064944 CCACCAGGAGGCGACTCCTCGGG + Exonic
1035568086 8:654968-654990 GCACCAGGGCGCAACTCCCCAGG - Intronic
1036257750 8:7218973-7218995 CTGCCTGGAAGCAACTCCAAGGG + Intergenic
1036309799 8:7677569-7677591 CTGCCTGGAAGCAACTCCAAGGG + Intergenic
1036891222 8:12598420-12598442 CTGCCTGGAAGCAACTCCAAGGG + Intergenic
1038536420 8:28356456-28356478 GTACCAGGAAACTCCTCCCCAGG + Intronic
1038718525 8:30012731-30012753 GCACCAGGAAGCAAGTTCCCAGG - Intergenic
1038875476 8:31543722-31543744 CTACCAGAAAGCACCTACCATGG - Intergenic
1039086703 8:33787369-33787391 CTCCCAGCCAGGAACTCCCCTGG - Intergenic
1041009897 8:53531399-53531421 CTCCTAGGAAGCAGCTCCCCAGG + Intergenic
1043471376 8:80566274-80566296 CAAACGGGAAGCAATTCCCCTGG + Intergenic
1046765103 8:118060535-118060557 CTCTCAGGAAGCCAGTCCCCAGG + Intronic
1047609260 8:126504956-126504978 CTACCAGGAAGAAATTCACAGGG + Intergenic
1056860622 9:90177684-90177706 CTAACTGGATGCAACTCTCCAGG - Intergenic
1057262049 9:93590455-93590477 CATCCAGGAAGCACCTGCCCTGG - Intronic
1189143132 X:38627554-38627576 CTGCCAGGTAGCTAGTCCCCAGG + Intronic
1195986505 X:110636470-110636492 CTACCAGAGAGCAAAACCCCAGG + Intergenic
1196463095 X:115949352-115949374 TGACCGGGAAGCAAATCCCCAGG + Intergenic
1198712554 X:139521454-139521476 CTATCAGGAAGCCACATCCCAGG + Intergenic
1199536071 X:148904762-148904784 CTAACAGAAAGCAATTCCCAAGG + Intronic