ID: 1084026332

View in Genome Browser
Species Human (GRCh38)
Location 11:66452376-66452398
Sequence TGGCAGGGGCTGGATCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084026332 Original CRISPR TGGCAGGGGCTGGATCTGAA GGG Intronic
900073183 1:790110-790132 TGGGATGGGATGGATTTGAATGG + Intergenic
901226498 1:7615907-7615929 TTGTAGGTGCTGGATGTGAATGG - Intronic
902096458 1:13950015-13950037 AGGCAGGGGCGGGATCTGGAAGG - Intergenic
902264851 1:15255998-15256020 GGGCAGGGGCAGATTCTGAAAGG - Intronic
902662687 1:17916236-17916258 GGGTAGGGGCGGGTTCTGAACGG - Intergenic
903133362 1:21293401-21293423 TGGCAGAGGCTGGGTCTCACGGG + Intronic
903474832 1:23612471-23612493 GGTCAGGGTCTGGCTCTGAAGGG - Intronic
903682276 1:25104960-25104982 TGGCAGGGGCTGGACCCTGAGGG - Intergenic
903764590 1:25725983-25726005 GGGCATGGGCTGGATCACAAAGG + Intronic
905003887 1:34694997-34695019 TGGCATGGGCTGGATCAGGCAGG + Intergenic
905072531 1:35239822-35239844 TGGCAGAGGCTGGACTTTAATGG + Intergenic
905299860 1:36979708-36979730 TGGCAGGAGCTGCAGTTGAAAGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
906727554 1:48054996-48055018 GGGCAAGGCCTGGATCTGCAGGG + Intergenic
907384692 1:54118414-54118436 AGGCAGGGGCTGGAGCACAAGGG - Intergenic
907461575 1:54608649-54608671 GGGCAGGGGCTGCATCTCCAGGG - Intronic
911729404 1:101277567-101277589 TGGCAGAGGCTGGATGTCACGGG - Intergenic
912545141 1:110445368-110445390 TGGCAGAGGCTATATCTGCATGG - Intergenic
916713425 1:167431690-167431712 GGGCAGGGCCTGCATGTGAAGGG + Exonic
917632650 1:176905067-176905089 AGGCAGGAGCTGGATCTTATAGG - Intronic
918200270 1:182259776-182259798 TGGCAGAGGCCAGATGTGAAGGG + Intergenic
919116631 1:193287955-193287977 AAGCAGGGGCTGAAGCTGAATGG + Intergenic
921716135 1:218418603-218418625 TGGGAGGGGCTGGGGCAGAATGG + Intronic
922801825 1:228368016-228368038 TGGCTGGGACTGTATCTGCAGGG - Intronic
923518684 1:234719565-234719587 TTGCAGGGGCAGAAGCTGAAAGG - Intergenic
924564883 1:245189032-245189054 TGTCAGGGGCTGGAGTTGAGGGG + Intronic
1064423937 10:15213677-15213699 GGGCTGGGGCTGGATCTGTGAGG + Exonic
1065314931 10:24454545-24454567 TAGCAGGGGCCTGATCTGTAGGG + Intronic
1066771979 10:38853757-38853779 TGGAAAGGGCTGGAATTGAATGG + Intergenic
1067146959 10:43701153-43701175 GGCCAGGGGCTGGGACTGAAGGG + Intergenic
1068266536 10:54656971-54656993 TGGCAGGGGCTTACTTTGAATGG - Intronic
1068981889 10:63071248-63071270 TGGCAGGGGCAGGAGGTGCAGGG + Intergenic
1070286105 10:75085122-75085144 TGCCTGGGGCAGGAACTGAAAGG - Intergenic
1070321292 10:75356702-75356724 TGGGTGGGGCTGGGGCTGAAAGG - Intergenic
1070918897 10:80171813-80171835 TGGCAGTGGCAGGATCTGGATGG + Intronic
1072769425 10:98125130-98125152 TGGCAGGGGCTGCTGCTCAAAGG + Intergenic
1073486165 10:103820418-103820440 TGCCAGGGGCTGCATCTGGTCGG + Intronic
1074189601 10:111124341-111124363 TAGCAGGGCCTGGAGCTGACAGG - Intergenic
1074779598 10:116791751-116791773 TGGCAGGGGCTGGAGGTGGGAGG - Intergenic
1075075945 10:119350189-119350211 TGAAAGGGGCTGGAGCTGGAGGG - Intronic
1075078008 10:119364176-119364198 GGGCTGGGGTTGGATCTGCAAGG - Intronic
1075166058 10:120069444-120069466 TGGCAGGGTCTGGACCAGAAGGG + Intergenic
1075575408 10:123573862-123573884 AGGCAGAGGCTGGATCTGTCAGG - Intergenic
1076182209 10:128419038-128419060 TGGCAGGAGCTGGGCCTGAGTGG + Intergenic
1076405804 10:130211987-130212009 GGCCAGAGGCTGGAACTGAAGGG - Intergenic
1077184177 11:1228987-1229009 TGGCGGGGGCTGGGGCTGGAGGG + Intronic
1078669084 11:13349027-13349049 TGGCAGAAACTGGCTCTGAAAGG - Intronic
1079392822 11:20036980-20037002 TGGCAAGGGATGGTTCTGAAAGG + Intronic
1082260050 11:50071703-50071725 AGGCAGGAGCTGGCCCTGAAGGG + Intergenic
1082260452 11:50073462-50073484 AGGCAGGAGCTGGCCCTGAAGGG + Intergenic
1083050445 11:59771742-59771764 TGGGTGGAGCTGGATCTTAAAGG + Intronic
1083143197 11:60738501-60738523 TGGCAGGGACTGGATTTGTTTGG - Intronic
1083305837 11:61761558-61761580 GGGCAGGGGCAGGACCTGGAGGG + Intronic
1083336416 11:61924285-61924307 TGGCAGGGGCTGTATCTCTGGGG - Intergenic
1083390015 11:62341837-62341859 TGCCAGGGGCTGGGAGTGAATGG - Intronic
1083472709 11:62894871-62894893 TGGGATGGGCTGGATATGAAGGG + Intergenic
1083491126 11:63015733-63015755 TGGCCGGGTCTGGATCCGATGGG + Exonic
1084026332 11:66452376-66452398 TGGCAGGGGCTGGATCTGAAGGG + Intronic
1084051427 11:66602692-66602714 TGGCAGGGAGTGTTTCTGAAGGG + Intronic
1084282045 11:68103577-68103599 GAGCAGGAGCTGGATCTTAATGG - Intronic
1084436685 11:69146312-69146334 GGGCAAAGGCTAGATCTGAAGGG - Intergenic
1084573598 11:69975017-69975039 TGGGAGGGGCTGGAGCTGGAGGG + Intergenic
1085130135 11:74031308-74031330 AGGCAAGGCCTGGATCTTAAAGG - Intronic
1085345509 11:75765875-75765897 TGACAGGGCCCAGATCTGAACGG - Intronic
1085402839 11:76244780-76244802 GGGCAGGGACTGGATCTGGAGGG - Intergenic
1085862311 11:80248686-80248708 AGGCAGGGACTAGATCTGATGGG - Intergenic
1086128877 11:83380106-83380128 TGGCAGGGGCTGTATTGAAAAGG + Intergenic
1088647317 11:111927225-111927247 CGGCAGGGGCTGGCTCTGGCTGG + Exonic
1089119308 11:116122349-116122371 TGTCAGGGGCTGGAGGAGAAAGG + Intergenic
1089460207 11:118648575-118648597 TGGTGGGGACTGGAGCTGAAAGG - Intronic
1089873467 11:121697045-121697067 TGGCAGGGGCTGGAAGAGTATGG + Intergenic
1090878596 11:130813689-130813711 GGGCAGGCCCTGGTTCTGAAGGG + Intergenic
1091061877 11:132471254-132471276 TGGCAGGGGATGGCTGTGGATGG + Intronic
1091435483 12:469514-469536 TGGCAAGTGCTGGATATGGATGG - Intronic
1091847510 12:3668816-3668838 TGGTAGGGGCTGCAACTTAAGGG + Intronic
1093752473 12:22816724-22816746 TGGCAGGCGTTGGAAATGAAAGG + Intergenic
1094330805 12:29290863-29290885 TGGGAGGGGGTGGATGGGAATGG + Intronic
1094497650 12:30998552-30998574 TGGCAGTGGCTTGAGCAGAAAGG + Intergenic
1094706249 12:32916698-32916720 TGCCAGGGGCTGGAGGGGAAGGG + Intergenic
1095715196 12:45337631-45337653 TAGCAGGGGCTGGAGGTGAGAGG + Intronic
1096825786 12:54276576-54276598 TGGCTGGGGCTGGAGATGGAAGG + Intronic
1097866507 12:64563565-64563587 AGGCAGGGGCTAGATCTTGAGGG - Intergenic
1101319250 12:103658818-103658840 AGGCAGGGGCTGGGTCTGTCTGG - Intronic
1101346848 12:103894034-103894056 TGGGAAGGGCTGGGTCTGTAAGG - Intergenic
1101987967 12:109462148-109462170 TGGCAGGGACTGGACCTGCCAGG - Intronic
1102145163 12:110649734-110649756 ACGCCTGGGCTGGATCTGAAAGG + Intronic
1103995091 12:124824366-124824388 TGCCAGGGGCTGGGGCAGAAAGG + Intronic
1105264472 13:18803820-18803842 TGGCTGGTGCTGGAGCTGCAGGG + Intergenic
1106250021 13:27976125-27976147 TAGAAGGAGCTGGAGCTGAAGGG - Intergenic
1106790577 13:33151634-33151656 AGGCAGGGGCTAGATCACAAAGG + Intronic
1107534465 13:41314562-41314584 CAGCAGGGGCTGGATGTGGAAGG - Intronic
1108870406 13:54977386-54977408 TGCCAGGGGCTGGAATTGAGGGG - Intergenic
1109117558 13:58407866-58407888 TGCCAATGGCTGGATATGAAAGG + Intergenic
1114364318 14:22010840-22010862 TAGCAGGGGCTGGAGCCTAATGG - Intergenic
1115951253 14:38724741-38724763 TGGGAGGGGCTGGTTATGACAGG - Intergenic
1116908069 14:50425265-50425287 TGGAAGAGTCTGGATTTGAAGGG - Intronic
1118437735 14:65786799-65786821 AGGCAGGGGCTGGATCTGGGTGG + Intergenic
1120308106 14:82796175-82796197 AGGCAGGTGCTGGACCAGAAAGG - Intergenic
1120839963 14:89076895-89076917 AGGCAGGGGCTGGATCTTAAAGG + Intergenic
1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG + Intergenic
1121847208 14:97183372-97183394 AGGCAAAGGCTGGATGTGAATGG + Intergenic
1122288235 14:100665535-100665557 TGGCAGGAGCTGGAACCGAAGGG - Intergenic
1122389240 14:101369018-101369040 TGGCAGAGGCAGCATCTGGAGGG + Intergenic
1122656824 14:103267658-103267680 TGGGAGGGGCTGGGGCAGAATGG - Intergenic
1202833977 14_GL000009v2_random:64248-64270 TGGCTGGTGCTGGAGCTGCACGG - Intergenic
1124178347 15:27448327-27448349 TGACTGGGGCTGGATCTGGAAGG + Intronic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1128546366 15:68571193-68571215 TGGCTGGGGCAGGATGGGAAAGG - Intergenic
1128569873 15:68726260-68726282 TGGCAGGGGCTCCATCTCAGTGG + Exonic
1129528024 15:76235040-76235062 TGGCAGAGGTGGGATTTGAATGG - Intronic
1129682096 15:77663759-77663781 TCCCAGGGGCTGAAGCTGAAGGG + Intronic
1129763169 15:78143674-78143696 TGGCAGGAGATGGATTTTAAGGG + Intronic
1130096595 15:80860821-80860843 AGGCAGGGGCTGGAGCTGTGTGG - Intronic
1131945645 15:97617463-97617485 TGCCAGGAGCTGGATCTGTGGGG + Intergenic
1132374352 15:101318949-101318971 AGGTAGGGGCTGCATCTGACAGG - Intronic
1133491660 16:6276057-6276079 TTGGAGGGGATGGATATGAAGGG + Intronic
1135665081 16:24328943-24328965 TGGCGGGGGCTGTCTCTGAGTGG - Intronic
1136271040 16:29148409-29148431 TGGCAGGGGCTGGCTCTCCCAGG + Intergenic
1136906701 16:34099396-34099418 TGGAATGGGATGGAACTGAAAGG - Intergenic
1137421656 16:48340052-48340074 TAGCAGGGGCTGGGGCAGAAAGG + Intronic
1138232713 16:55350704-55350726 TGGCAGAGAATGGATCTGAAGGG + Intergenic
1138596059 16:58029571-58029593 TGGCAAGGGCTGGGTGTGAAGGG - Intronic
1139547497 16:67656573-67656595 GGGGAGGGGCTGGTTCTGCAGGG - Exonic
1139912884 16:70409020-70409042 TAGCAGGTGGTGGATCTGAAGGG - Intronic
1140413064 16:74753045-74753067 TAGCAGAAGCTGGAGCTGAAGGG + Intronic
1141114257 16:81294969-81294991 TAGCTGGGGCTGGACCTCAAAGG - Intergenic
1141389942 16:83656093-83656115 TGCCAGGGGCTGGGTGTGAGGGG - Intronic
1142074655 16:88110418-88110440 TGGCAGGGGCTGGCTCTCCCAGG + Intronic
1142256278 16:89015273-89015295 TAGCAGGGGCTGGATGAGGAGGG + Intergenic
1143054677 17:4153997-4154019 TGGCAGGTGCTGCCTCTGAAGGG + Intronic
1144773500 17:17772286-17772308 TGGCAGGGGCTGGAAATGCAGGG - Intronic
1145272529 17:21412504-21412526 TGACAGGGGCTGGATTTGTGTGG - Intronic
1145310739 17:21699967-21699989 TGACAGGGGCTGGATTTGTGTGG - Intronic
1145704935 17:26863470-26863492 TGGAAGGGAATGGATTTGAATGG + Intergenic
1145860964 17:28209654-28209676 TGTCAGGGGCTGGATGAGGACGG + Intergenic
1146289715 17:31598580-31598602 GGGGAGGGGTTGGCTCTGAAGGG + Intergenic
1146522523 17:33537149-33537171 TGGCAGAGGCTGAGTCAGAAAGG - Intronic
1146559598 17:33856879-33856901 GGCCAGGGGCCGGGTCTGAAAGG + Intronic
1146951642 17:36910648-36910670 TGGCAGGGCTTCGATGTGAATGG - Intergenic
1147141076 17:38460945-38460967 TGGCGGGCGCTGGACCTGCACGG + Intronic
1147443207 17:40460036-40460058 TGGCAGTGGCTGGAACTTCAGGG - Intergenic
1148318860 17:46731730-46731752 TGGCAGGGGTTCTCTCTGAAGGG + Intronic
1149510582 17:57237734-57237756 TGGCAAGAGCTGCAACTGAAGGG - Intergenic
1149574872 17:57704607-57704629 AGACAGGGGCTGGATTGGAAGGG - Intergenic
1150935344 17:69629057-69629079 CGGCAGTGGCTGGGGCTGAAGGG + Intergenic
1151144586 17:72029281-72029303 TGGGAGGGGTTGGAGTTGAAGGG - Intergenic
1152294114 17:79456738-79456760 GGGCAGAGGCAGGCTCTGAAGGG - Intronic
1152798128 17:82317828-82317850 TGGCAGGGTCTGGAAGTGAGCGG + Intergenic
1203177154 17_KI270729v1_random:27384-27406 TGGAAGGGAATGGAACTGAATGG + Intergenic
1203199421 17_KI270729v1_random:261903-261925 TGGCATGGAATGGAACTGAATGG + Intergenic
1203209021 17_KI270730v1_random:62643-62665 TGGCATGGAATGGAACTGAATGG + Intergenic
1153330284 18:3866779-3866801 GGGCAGGGGCTGGGACTGGAAGG + Intronic
1154295097 18:13140547-13140569 TGGCAGGGGGTGGATGTGTAGGG + Intergenic
1154428409 18:14289853-14289875 TGGCTGGAGTTGGATCTGCAGGG - Intergenic
1155717334 18:28961346-28961368 TGGCTGAGGCTGGATCAGGAAGG - Intergenic
1155726905 18:29097657-29097679 TTGCAGGGTCTGAATATGAAGGG - Intergenic
1156477647 18:37416327-37416349 TGACAGGGGGAGGATCTGCATGG - Intronic
1156486963 18:37472402-37472424 GGGCCGGGGATGGATCAGAAGGG + Intronic
1157574295 18:48733369-48733391 AGGCTGCGGCTGGATCTGCAGGG - Intronic
1157884772 18:51356064-51356086 TGGCAGTGTCTGAACCTGAATGG + Intergenic
1158195540 18:54881314-54881336 TGGCAGGGGTGGGTTCTAAAGGG + Intronic
1158821934 18:61170360-61170382 TGGGTAGGGCTGCATCTGAATGG - Intergenic
1159923777 18:74248797-74248819 TGGCAGGAGCTTGTTCTGACTGG - Intergenic
1160310274 18:77783205-77783227 AGGCAGGTGCTGGATTTTAAAGG - Intergenic
1160503933 18:79416945-79416967 TGGGCTGGGCTGGCTCTGAAGGG + Intronic
1160742653 19:694679-694701 CAGCAGGGGCTGGATTTAAAGGG - Intronic
1161302796 19:3551146-3551168 AGGCAGGGGCTGAAGATGAAGGG + Exonic
1161352814 19:3803381-3803403 TGGCAGGGGCTGGGTGTGCAGGG - Intergenic
1162724372 19:12681165-12681187 GGGAAGGGACCGGATCTGAAAGG - Intronic
1162781230 19:13007902-13007924 TGGCAGGGGCTGGCCCTGAATGG + Intronic
1162797792 19:13095588-13095610 GGGCAGGGGCAGGAACTGATGGG - Exonic
1162946372 19:14046422-14046444 GGGCAGAGGCTGAATCTGGAGGG - Exonic
1164145781 19:22511663-22511685 TGGCAGGAGCAGGATCAGAAGGG + Intronic
1165437304 19:35803064-35803086 AGGCAGCGGCTGTAACTGAAGGG + Exonic
1166188182 19:41156501-41156523 GGGAAGGGGCTGGATCATAAAGG - Intergenic
1167217651 19:48175503-48175525 TGTCAAGGGCTGGATCTGGCAGG + Intronic
1167598055 19:50437604-50437626 AGGCAAGGGGTGAATCTGAAGGG + Intronic
1167637998 19:50666572-50666594 TGACAGGGGCTGGAACCGATGGG - Exonic
1202638706 1_KI270706v1_random:63444-63466 TGGCTGGTGCTGGAGCTGCACGG + Intergenic
925481801 2:4283779-4283801 TGCCAGGGGCAGGAACTGATGGG - Intergenic
925843775 2:8017627-8017649 TGGCAGGAGGTGGATATGACAGG + Intergenic
925918892 2:8625957-8625979 TGGCACGGGCTGGATGAGAAAGG - Intergenic
928156708 2:28883434-28883456 TGCCTGGGGCTGGATGGGAATGG - Intergenic
928295328 2:30077718-30077740 CGGAAGGGGATGGATCAGAAAGG - Intergenic
928389055 2:30895199-30895221 TGTCAGGGTCTGGCTCTCAAAGG - Intergenic
929160213 2:38824337-38824359 TGCCAGGGGCTGGACATGAGGGG + Intronic
929444983 2:41994626-41994648 TGGCAGGAGATGGACCTGGAGGG - Intergenic
929812473 2:45202139-45202161 TGGCAGGGGAGGGGTCTGATTGG - Intergenic
929848422 2:45557187-45557209 TGGCAGTGGCTGGATCATAAAGG + Intronic
932119765 2:69087876-69087898 TGGCAGTTGGTGGATTTGAAGGG - Intronic
932501813 2:72188847-72188869 TGACAGTGGATGGATCTGGATGG - Intronic
933656190 2:84888842-84888864 TAGCAGGAGCTGGAAGTGAAGGG + Intronic
935130299 2:100256611-100256633 TGTCAGGGGCCGCATCTGACGGG + Intergenic
935239724 2:101168097-101168119 TGGTAGGAGCTGGAGCTGTAGGG - Intronic
938196822 2:129335834-129335856 TGGCAGGGGCAGGAGACGAATGG + Intergenic
938227385 2:129627566-129627588 AGGCAGGGGCTGCATCCGCAAGG + Intergenic
938716705 2:134028049-134028071 GGGCAGGGGCGGGAACGGAAGGG - Intergenic
939163206 2:138613030-138613052 TGCCATGTGCTGGATCTCAAGGG - Intergenic
939837626 2:147150182-147150204 TGGAAGGGGCTGGAGCAGCAGGG - Intergenic
940910108 2:159203066-159203088 TGGCAAGTGCTGGAGCAGAAGGG - Intronic
941642873 2:168008048-168008070 TGCCAGGGGCTGGCAATGAAGGG - Intronic
941660703 2:168192895-168192917 TGGCAGGAGCTGGGGCTGAGTGG - Intronic
941811096 2:169756798-169756820 TCGCAGAGGCTGGCTGTGAAGGG - Intronic
946241613 2:218359463-218359485 TGGCTGGGGCTGGGTGTGAGGGG + Intronic
947341256 2:229142145-229142167 GGGCGGGGGCTGTATTTGAATGG + Intronic
947528285 2:230892972-230892994 TGGCAGTGGCAGGTGCTGAAAGG - Intergenic
948991048 2:241554186-241554208 CGTCAGGGGCTGGCTCTGTATGG + Intergenic
1168891843 20:1300049-1300071 TGGCAGATGCTGGGTCTGCATGG - Intronic
1168955236 20:1829896-1829918 TGGCAGGGGCTGGACCCATAAGG + Intergenic
1169213960 20:3783262-3783284 AGGGAGGGGCTGGCTCTGAAAGG + Intergenic
1169611974 20:7391520-7391542 TAGCAGGGGCTGGTTCTGCAGGG - Intergenic
1169661645 20:7984915-7984937 TGCCTGAGGCTGGCTCTGAATGG - Intronic
1169867932 20:10219731-10219753 TGGCCGGGGCTGGATGTGCCAGG + Intronic
1170117275 20:12873673-12873695 GGACAGGGAATGGATCTGAAGGG + Intergenic
1170635583 20:18101309-18101331 TGGCAGGGGCTGGAAGGGCAAGG + Intergenic
1171885298 20:30647564-30647586 TGGCTGGTGCTGGAGCTGCACGG + Intergenic
1172840377 20:37899437-37899459 GGGCAGAGGCTGAATGTGAACGG - Intergenic
1172896563 20:38304423-38304445 TGCCAGGTGCTGGATCTAAAGGG - Intronic
1173083760 20:39894898-39894920 TGTCAGGTCCTGGATCTTAAGGG - Intergenic
1173331583 20:42080143-42080165 TGGGAGGGGGTGGAACTGCAGGG - Exonic
1173404589 20:42753593-42753615 TGGCAGGGGCTGCAGGTGAGTGG + Intronic
1173415384 20:42850465-42850487 TGGCAAGGGCTGGATATGTAAGG + Intronic
1173569259 20:44066169-44066191 TGGCAGGGCCAGGGTTTGAAAGG - Intronic
1173583549 20:44164748-44164770 TGCCAGGGGCTGGGTGTGGAAGG + Intronic
1174443586 20:50575469-50575491 TAGCACGGGCTTTATCTGAAGGG + Intronic
1174514099 20:51078039-51078061 TTGCAGGGGCTGGAGCCCAATGG - Intergenic
1174768068 20:53272383-53272405 GGGCAGGGGCTGCATCTGACTGG + Intronic
1175520763 20:59601450-59601472 TGGCAAGGGGTGGATTTGGAAGG - Intronic
1175803548 20:61814458-61814480 TGTGAGGGGCTGGGTCTGCAGGG - Intronic
1176100499 20:63362295-63362317 TGGGAGGGGCAGGAGCTGTAGGG - Intronic
1176125714 20:63473576-63473598 TGGCAGGGGCAGGGACTGGAGGG + Intergenic
1176217499 20:63955346-63955368 TGGGAGGGTGTGGACCTGAAGGG + Intronic
1176636096 21:9246169-9246191 TGGAATGGGATGGATTTGAATGG + Intergenic
1176752162 21:10699685-10699707 TGGAATGGACTGGAACTGAACGG - Intergenic
1176849095 21:13899111-13899133 TGGCTGGAGCTGGATCTGCAGGG + Intergenic
1176849550 21:13902262-13902284 TGGCTGGTGCTGGAGCTGCAGGG + Intergenic
1177827179 21:26096944-26096966 TGGCAGAGACCGGATCTGACAGG + Intronic
1178365798 21:31987861-31987883 TGGCAGGGGGTGGAGCTGGATGG + Intronic
1178775246 21:35543752-35543774 TGGCAGTGGCTGGAATTTAATGG - Intronic
1179465561 21:41569338-41569360 TGGCAGGGGGTGCACCTGAGGGG - Intergenic
1179532902 21:42032277-42032299 TGTCATGGGCTGCATATGAAGGG - Intergenic
1179911229 21:44449946-44449968 GGGCAGGGGCTGGGTCAGGAGGG + Intergenic
1180363261 22:11918445-11918467 TGGCTGGTGCTGGAGCTGCACGG - Intergenic
1180531696 22:16354980-16355002 TGGAAGGGAATGGAACTGAATGG + Intergenic
1180622048 22:17168861-17168883 TGGCAGGAGCTGTATTTGGAGGG - Intergenic
1180867117 22:19126061-19126083 GGGCAGGGGCCAGAGCTGAAAGG + Intergenic
1181007838 22:20022490-20022512 AGGCAGGGGCTTGGTCTGAGGGG - Intronic
1181043033 22:20201808-20201830 GGGCAGGGGCTGGATGGGACTGG + Intergenic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1181481115 22:23199665-23199687 GTGCAGGGGATAGATCTGAAAGG + Intronic
1181877302 22:25949565-25949587 TGACAGAGGTTGGATCTGAAGGG + Intronic
1181944466 22:26505258-26505280 TGACAGGGGCTGTGTCTCAATGG + Intronic
1182731860 22:32502503-32502525 TGGAAGGGGCAGAACCTGAAAGG + Intergenic
1183367137 22:37412798-37412820 TGCCAGAGGCTGGACCTGGAGGG - Intronic
1184149402 22:42629603-42629625 GGGCAGGCACTGGATCTGAAGGG - Intronic
1184202139 22:42977658-42977680 TGGCAGGGGAGGGACCTGATGGG + Intronic
1184240167 22:43207672-43207694 GGGCAGAGGCTGGAGGTGAAAGG - Intronic
1184339651 22:43879278-43879300 AGGCAGGGGCTGGGTCAGGAGGG - Intergenic
1184389175 22:44193007-44193029 TGGCTGGGGCTGGAGCTGTGTGG + Intronic
1184525430 22:45019983-45020005 TGGGAGGGGCTGGGGCAGAAGGG + Intergenic
1203317946 22_KI270737v1_random:30807-30829 TGGAAGGGAATGGAACTGAATGG - Intergenic
949320921 3:2809473-2809495 AGGCAGGGGCTGGATCCTGAAGG + Intronic
949380223 3:3436435-3436457 TGGCTGGGGCTGGATCACACTGG - Intergenic
950689037 3:14641171-14641193 GGGAAGGGGCTGAATCTGCAGGG - Intergenic
951412356 3:22380316-22380338 GTCCAGGGGCTGGAGCTGAATGG - Intergenic
953858999 3:46526385-46526407 TTCCAGGGGCTGGATGTGGAAGG + Intronic
954533712 3:51342429-51342451 TGTCAGGCGCTGGATCAGCAAGG - Intronic
954609797 3:51938213-51938235 AGGAAGGGGCTGGGTCTGAGGGG + Intronic
954992579 3:54854034-54854056 TGGCAGGGGCTGGCTCTGCATGG - Intronic
955377257 3:58408471-58408493 TGGCTGGGGTAGGATTTGAATGG + Intronic
956153522 3:66268738-66268760 TGGCAGGGGAGGGACCTGATGGG + Intronic
960909752 3:122637459-122637481 AGGGAAGGGATGGATCTGAAAGG - Intronic
966827480 3:183977241-183977263 TGGAAGGGGCTAGCTCTAAAGGG + Intronic
967458532 3:189718544-189718566 TGTCAGGGGAGGGATCTGATGGG - Intronic
968027115 3:195451687-195451709 TGGCAGGTGCTGGATATTGAAGG - Intergenic
968280648 3:197474240-197474262 TGTCAGGGGAGGGATCTGGAGGG + Intergenic
968319514 3:197752260-197752282 TGGCAGAGGCAGGACCTGAAAGG - Intronic
968515471 4:1013763-1013785 TGGCTGGGGCTGAAGCTGACTGG + Intronic
969917628 4:10506360-10506382 TGCCAGGGGCTGCATCTCACTGG - Intronic
971235997 4:24842931-24842953 TAGCAGAAGCTGGATCTGAACGG - Intronic
971315761 4:25566541-25566563 TGGCAGGGATTGGATTTTAATGG + Intergenic
971415715 4:26426857-26426879 TGGCAGGAACTGAATCTGTAAGG + Intronic
974480999 4:62442664-62442686 AGGCAAGGGCTAGATCTTAAGGG + Intergenic
977403769 4:96569622-96569644 CAGCAGGGGCTGGCTCTGCATGG - Intergenic
977725812 4:100295816-100295838 AGGTAGGGTCTGGATCTGATAGG + Intergenic
981239154 4:142454283-142454305 TGGCAAGGGCAGAATGTGAAAGG - Intronic
982291585 4:153788264-153788286 TGGCAGGGGCGGGATCTCCTGGG + Intronic
1202766044 4_GL000008v2_random:149303-149325 TGGCTGGTGCTGGAGCTGCACGG + Intergenic
985832909 5:2249221-2249243 TCACATGGGCTGGATCTGCAGGG - Intergenic
985913091 5:2897991-2898013 TGGCAGAGGCTAGATAAGAATGG - Intergenic
986672657 5:10156846-10156868 GGACAGGGGCTGGACCTGTAAGG + Intergenic
988083793 5:26446826-26446848 TGTCAGGGGCAGGACCTGATGGG - Intergenic
989447265 5:41544939-41544961 TGGCAGGGGCTGGGGATAAATGG - Intergenic
990191479 5:53264841-53264863 TGGCAGGGGGTGCACATGAAAGG - Intergenic
990334833 5:54762340-54762362 TGGCAGAGTGTGGATCTGAGAGG + Intergenic
990772529 5:59265215-59265237 AGGCAGGGGTTTCATCTGAAAGG - Intronic
995523306 5:113031172-113031194 TGGAAGGGGCAGGATCTTTAAGG + Intronic
996084227 5:119287603-119287625 TGCCAGGGGCTGGGTTTGGAGGG - Intronic
997261199 5:132466651-132466673 TGGCAGCTGCTGGGTGTGAACGG + Intronic
998554226 5:143107267-143107289 AGGCAGGGGCTGGATCGTATAGG + Intronic
998811516 5:145971323-145971345 TGCCAGGGGCTGGATCCAGAGGG - Intronic
999236368 5:150099699-150099721 TGCCAGGGGCTGGAGATGGAGGG + Intronic
1000836636 5:166163238-166163260 TGACAGTGGCTGGATGTGACAGG - Intergenic
1001083942 5:168686912-168686934 TGGCAGGGGCTGGGGCTGACTGG - Intronic
1001329604 5:170752846-170752868 TGGCAGGGGGTGGATGTGATGGG - Intergenic
1001683679 5:173576931-173576953 TGGCAGGGGCCAGATCTCATAGG + Intergenic
1002200864 5:177527310-177527332 TGGCAGGGGCTGATCGTGAAGGG + Intronic
1002301462 5:178259641-178259663 GGGCAGGGGCTGGGACGGAATGG - Intronic
1003268515 6:4587642-4587664 TGGCAGGCACTGGATCTGGAAGG - Intergenic
1003512615 6:6793946-6793968 TGGGAGGGGCAGGGTCAGAAGGG - Intergenic
1004272668 6:14209811-14209833 TGGCAGGGTCTGAATCAGAGTGG + Intergenic
1006866889 6:37215910-37215932 TGGCAGGGGCCAGATCAGGAAGG + Intronic
1007469122 6:42076917-42076939 AGGCAGGGGCTGGCTATGAAGGG - Intronic
1008568087 6:52788934-52788956 TGGCAGGGGATGTCTGTGAAGGG + Intergenic
1008572275 6:52827514-52827536 TGGCAGGGGATGTCTGTGAAGGG + Intergenic
1008892199 6:56507822-56507844 TGGCAGGGGATGCCTCTGACGGG + Intronic
1009732283 6:67623108-67623130 TGGGAGGGGCTGGGTTGGAATGG + Intergenic
1010840276 6:80641691-80641713 TGGCACAGGCAGGCTCTGAATGG + Intergenic
1014251143 6:119116705-119116727 TGGCATTGACTGGATCTCAAAGG + Intronic
1015692157 6:135937346-135937368 TGGCAGGGGCCAGATCAGGAAGG - Intronic
1015694277 6:135962894-135962916 TGTCATGGGCTGGATGTCAATGG - Intronic
1015712820 6:136160716-136160738 TGGCAGGGGTCAGATCAGAACGG - Intronic
1017074630 6:150606445-150606467 GGGAAGGGGTTGGATCTAAATGG - Intronic
1017445586 6:154504536-154504558 TACCAGGGGGTGGAGCTGAATGG - Intronic
1018101563 6:160445374-160445396 GGGCAGGGACTGGATCCGGAAGG + Intronic
1018843438 6:167536127-167536149 TAGCAGGGGCTGGATTTGAGAGG - Intergenic
1018876424 6:167826516-167826538 TGGGCGGTGCTGGATCTGGACGG - Intergenic
1018906806 6:168080288-168080310 GGGAAGGGTCTGGATCTGAGCGG - Intronic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1021608305 7:22431829-22431851 TGGCAAGAGCTGGAGCTGGAAGG - Intronic
1022469795 7:30675130-30675152 TGGCAGGTGCTGTGTGTGAAAGG + Intronic
1022706803 7:32809508-32809530 TTCCAGGGGCTGGATGAGAAAGG + Intergenic
1023728820 7:43170615-43170637 TAGCAGGGGTTGCATTTGAAAGG + Intronic
1026054241 7:66970817-66970839 TGGCTGGAGCTGGATGTGGAGGG + Intergenic
1027355373 7:77349077-77349099 TGGCAAGTGCTGGTTCTGGAAGG + Intronic
1029406073 7:100374654-100374676 GGGGCGGGGCTGGATCTGGAGGG - Intronic
1029551910 7:101241035-101241057 TGGGAGTGACTGGAGCTGAAAGG - Intronic
1029624813 7:101714075-101714097 AGGCACTGGCTGGATTTGAAAGG - Intergenic
1031679109 7:124649226-124649248 TGGAAGGGGCAGGCTCTGGAGGG - Intergenic
1032756233 7:134893265-134893287 TGTAGGGGGCTGGATCAGAAAGG - Intronic
1035758482 8:2051692-2051714 CGGCACTGGCTGGCTCTGAAGGG + Intronic
1036966163 8:13300629-13300651 GGGCAGAGGGTGGATCTGAGGGG + Intronic
1037260804 8:17005794-17005816 TAGCAGGGGATGGATATGAATGG + Intergenic
1037390297 8:18386245-18386267 TGGCAGAGGGTGGAGCTGAGTGG - Intergenic
1037650298 8:20831231-20831253 TGACAGGGAAGGGATCTGAAGGG + Intergenic
1037654570 8:20872107-20872129 TGGCAGGGGCAGGGTGTGCAGGG + Intergenic
1039569180 8:38573459-38573481 AGGCAGGGGATGGAGGTGAAAGG + Intergenic
1040690987 8:49938075-49938097 TGGCATGGCATGGATTTGAAAGG - Intronic
1041206298 8:55501461-55501483 TGCCAGGGGCTGGAGGTGAGGGG - Intronic
1041567939 8:59301878-59301900 TGGAAGGGGCTGGATTTTATGGG + Intergenic
1042402985 8:68370984-68371006 TGGCTGGGGGTGGGTCTTAAGGG + Intronic
1043370846 8:79590587-79590609 TGCCAGGGGCTGGAGGTGGAGGG + Intergenic
1046104063 8:109645369-109645391 TGGAAGGGGTTGCATCAGAAAGG + Exonic
1047006896 8:120630136-120630158 AGGTAGAGACTGGATCTGAAGGG - Intronic
1047524886 8:125624471-125624493 TGGCAGGGGCCGGATCATGAAGG + Intergenic
1047822184 8:128533090-128533112 AGGCAGGGGCAAGATCAGAAAGG + Intergenic
1048215850 8:132493950-132493972 TGGATGGGGCTGGATCAGGAGGG + Intergenic
1048288737 8:133163613-133163635 AGGTAGGGTCTGGATCTGATTGG + Intergenic
1048954846 8:139527142-139527164 TGGCAGGGGCTGGGTCTGCATGG + Intergenic
1049242220 8:141543812-141543834 TGGCAGGGGAAGGTTCAGAATGG - Intergenic
1049797395 8:144503006-144503028 GGGCAGGGGCTGGCTCTGCCTGG + Intronic
1050170999 9:2816574-2816596 TGCCAGGGACTGGAGCTGAATGG + Intronic
1051265600 9:15306516-15306538 TGCCAGGGGCTGGGGCTGGAGGG - Intronic
1052779133 9:32762402-32762424 TGGCAGGGGCTGGAGCTCACTGG - Intergenic
1052877756 9:33580207-33580229 TGGCTGGAGCCGGATCTGCAGGG - Intergenic
1052879507 9:33592595-33592617 TGGCTGGAGCTGGAGCTGCAGGG - Intergenic
1052879952 9:33595657-33595679 TGGCTGGAGCTGGAGCTGCAGGG - Intergenic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1053496021 9:38548563-38548585 TGGCTGGAGCTGGAGCTGCAGGG + Intronic
1053496471 9:38551637-38551659 TGGCTGGAGCTGGAGCTGCAGGG + Intronic
1053498229 9:38563998-38564020 TGGCTGGAGCCGGATCTGCAGGG + Intronic
1055501214 9:76904094-76904116 TTGCTGTGGCTGGATGTGAAAGG + Intronic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1056586130 9:87928374-87928396 TGGCTGGAGCTGGAGCTGCAGGG + Intergenic
1056610752 9:88124569-88124591 TGGCTGGAGCTGGAGCTGCAGGG - Intergenic
1056816916 9:89808594-89808616 TGGCAGGGGCTGGAGCCGGACGG - Intergenic
1056871718 9:90288023-90288045 TGGCTGGGGCAGGCTCTGATGGG - Intergenic
1057034151 9:91799572-91799594 TGGCAGAGGCAGGCTCTGCATGG - Intronic
1057161400 9:92890875-92890897 TGGCTGGAGCTGGAGCTGCACGG + Intergenic
1057676390 9:97139177-97139199 TGGCTGGAGCTGGAGCTGCAGGG + Intergenic
1057677694 9:97148482-97148504 TGGCTGGAGCTGGAGCTGCAGGG + Intergenic
1059503673 9:114778592-114778614 TGGTAGGGACTGGATCAGGAAGG + Intergenic
1060484669 9:124039588-124039610 AGGCAGGGGGTGGATGTGAGGGG + Intergenic
1060989247 9:127838795-127838817 GGGCAGGGGCTGGATCTCGCTGG - Intronic
1061067312 9:128286545-128286567 AGCCAGGGGATGGAACTGAAGGG - Intronic
1061442561 9:130616222-130616244 GGGCAGGAGCTGGAGCTGGATGG + Intronic
1061493530 9:130959191-130959213 GGGCCTGGGCTGAATCTGAATGG + Intergenic
1062296112 9:135828086-135828108 CCCCAGGGGCTGGAGCTGAAGGG - Intronic
1062580123 9:137225737-137225759 TGGCAGGGGCTGCATCTCCGAGG - Exonic
1203724942 Un_GL000216v2:42075-42097 TGGAAGGGAATGGATTTGAATGG - Intergenic
1203546793 Un_KI270743v1:134192-134214 TGGCTGGTGCTGGAGCTGCACGG + Intergenic
1203680826 Un_KI270756v1:62600-62622 TGGAAAGGGCTGGAATTGAATGG - Intergenic
1187514444 X:19954566-19954588 TGACAGGGACTGGAGCTGAGAGG + Intronic
1188002531 X:24995653-24995675 CGGCGGGGGCTGCATCTGACTGG + Intronic
1190108008 X:47572947-47572969 TGGGCGGGGCTGGCTCTGGAAGG + Exonic
1192212104 X:69134212-69134234 GAGCAGGGGCCGGATCTCAAGGG - Intergenic
1196812127 X:119637012-119637034 TGGCAGGAGCGGTACCTGAAGGG + Exonic
1197599993 X:128517711-128517733 TGGCAGGGGCTGGAAAACAAGGG - Intergenic
1197992635 X:132334461-132334483 TGGCAGGAGCTGGATCAAAATGG + Intergenic
1199443343 X:147894127-147894149 TGCCAGGGGCTGGGTATGAGAGG + Intergenic
1201124246 Y:10899253-10899275 TGGAAGGGGGTGGAATTGAATGG - Intergenic
1201132904 Y:10968298-10968320 TGGCAGGGACTGGAGGTGAGTGG - Intergenic
1201209132 Y:11663225-11663247 TGGCATGGAATGGATCGGAAGGG + Intergenic
1201209206 Y:11663863-11663885 TGGAATGGACTGGATTTGAATGG + Intergenic
1201210358 Y:11674896-11674918 TGGAATGGGCAGGATTTGAATGG + Intergenic