ID: 1084026814

View in Genome Browser
Species Human (GRCh38)
Location 11:66455847-66455869
Sequence AGCACTCAGCTCCTAACGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084026814_1084026821 6 Left 1084026814 11:66455847-66455869 CCCCACGTTAGGAGCTGAGTGCT 0: 1
1: 0
2: 3
3: 9
4: 122
Right 1084026821 11:66455876-66455898 AGGGCAAGTGCAGCAGCCCCAGG 0: 1
1: 0
2: 6
3: 40
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084026814 Original CRISPR AGCACTCAGCTCCTAACGTG GGG (reversed) Intronic