ID: 1084028479

View in Genome Browser
Species Human (GRCh38)
Location 11:66467128-66467150
Sequence CAGCCACCGGCGCCCGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084028479_1084028490 17 Left 1084028479 11:66467128-66467150 CCGAGGGCGGGCGCCGGTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1084028490 11:66467168-66467190 CCTGCGGTCGCGGGTGCGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 198
1084028479_1084028481 1 Left 1084028479 11:66467128-66467150 CCGAGGGCGGGCGCCGGTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1084028481 11:66467152-66467174 TGCGCGCCCGCGCGTCCCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 96
1084028479_1084028486 13 Left 1084028479 11:66467128-66467150 CCGAGGGCGGGCGCCGGTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1084028486 11:66467164-66467186 CGTCCCTGCGGTCGCGGGTGCGG 0: 1
1: 0
2: 2
3: 5
4: 65
1084028479_1084028487 14 Left 1084028479 11:66467128-66467150 CCGAGGGCGGGCGCCGGTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1084028487 11:66467165-66467187 GTCCCTGCGGTCGCGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 93
1084028479_1084028485 8 Left 1084028479 11:66467128-66467150 CCGAGGGCGGGCGCCGGTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1084028485 11:66467159-66467181 CCGCGCGTCCCTGCGGTCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 248
1084028479_1084028483 7 Left 1084028479 11:66467128-66467150 CCGAGGGCGGGCGCCGGTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1084028483 11:66467158-66467180 CCCGCGCGTCCCTGCGGTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084028479 Original CRISPR CAGCCACCGGCGCCCGCCCT CGG (reversed) Intronic