ID: 1084028480

View in Genome Browser
Species Human (GRCh38)
Location 11:66467141-66467163
Sequence CGCGGGCGCGCAGCAGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 139}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084028480_1084028483 -6 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028483 11:66467158-66467180 CCCGCGCGTCCCTGCGGTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1084028480_1084028491 20 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028491 11:66467184-66467206 CGGGTGGTCTCTGCGCCGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 35
1084028480_1084028495 28 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028495 11:66467192-66467214 CTCTGCGCCGTCCGGGCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 113
1084028480_1084028493 26 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028493 11:66467190-66467212 GTCTCTGCGCCGTCCGGGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 94
1084028480_1084028487 1 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028487 11:66467165-66467187 GTCCCTGCGGTCGCGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 93
1084028480_1084028494 27 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028494 11:66467191-66467213 TCTCTGCGCCGTCCGGGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 111
1084028480_1084028486 0 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028486 11:66467164-66467186 CGTCCCTGCGGTCGCGGGTGCGG 0: 1
1: 0
2: 2
3: 5
4: 65
1084028480_1084028492 21 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028492 11:66467185-66467207 GGGTGGTCTCTGCGCCGTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 87
1084028480_1084028485 -5 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028485 11:66467159-66467181 CCGCGCGTCCCTGCGGTCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 248
1084028480_1084028490 4 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028490 11:66467168-66467190 CCTGCGGTCGCGGGTGCGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084028480 Original CRISPR CGCGGGCGCGCAGCAGCCAC CGG (reversed) Intronic