ID: 1084028483

View in Genome Browser
Species Human (GRCh38)
Location 11:66467158-66467180
Sequence CCCGCGCGTCCCTGCGGTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084028480_1084028483 -6 Left 1084028480 11:66467141-66467163 CCGGTGGCTGCTGCGCGCCCGCG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1084028483 11:66467158-66467180 CCCGCGCGTCCCTGCGGTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 69
1084028479_1084028483 7 Left 1084028479 11:66467128-66467150 CCGAGGGCGGGCGCCGGTGGCTG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1084028483 11:66467158-66467180 CCCGCGCGTCCCTGCGGTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084028483 Original CRISPR CCCGCGCGTCCCTGCGGTCG CGG Intronic