ID: 1084028551

View in Genome Browser
Species Human (GRCh38)
Location 11:66467391-66467413
Sequence TGTGCTGCAGCCCGAGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084028542_1084028551 26 Left 1084028542 11:66467342-66467364 CCCTCTGGCGCGGGGATGTTTTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 130
1084028548_1084028551 4 Left 1084028548 11:66467364-66467386 CCAAACGGGCTGCCTGCGGGAGA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 130
1084028543_1084028551 25 Left 1084028543 11:66467343-66467365 CCTCTGGCGCGGGGATGTTTTCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 130
1084028550_1084028551 -8 Left 1084028550 11:66467376-66467398 CCTGCGGGAGACGGCTGTGCTGC 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084028551 Original CRISPR TGTGCTGCAGCCCGAGCTCG AGG Intronic
900437344 1:2637473-2637495 TGGGCTGCAGGCCGATCTCCTGG + Intronic
900548651 1:3242516-3242538 CGTGCTGGAGGCAGAGCTCGAGG - Intronic
901013995 1:6217392-6217414 TGTGCTGGAGCGGGAGCTGGGGG - Intronic
901190508 1:7407313-7407335 TTTGGTGCAGCCCAGGCTCGGGG + Intronic
904401214 1:30257921-30257943 TGTGCAGGTGCCCGGGCTCGTGG - Intergenic
909695630 1:78465382-78465404 TGTGCTGCAGGCTGAGCTGGGGG + Intronic
913521454 1:119648540-119648562 AGCGCTGCACTCCGAGCTCGCGG + Intergenic
915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG + Exonic
915355994 1:155255433-155255455 CCTGCGGCAGCCGGAGCTCGGGG - Intronic
915900255 1:159841552-159841574 TGAGCTGCAGCGAGAGCTGGGGG - Intronic
916209059 1:162343885-162343907 TGTGCTGCAGGCTCAGCTTGTGG - Exonic
917794400 1:178522168-178522190 TGTGGTGCAGGCAGAACTCGAGG - Intronic
918292729 1:183124475-183124497 TGGGCTGCAGCCCTGGCACGGGG - Intronic
922821232 1:228487270-228487292 TGTGCTGCAGCCGGAGGTCCTGG - Exonic
922883976 1:229003878-229003900 TGGCCTGCAGCCCTTGCTCGAGG - Intergenic
1070152860 10:73815695-73815717 TGTTCTGCAGCCCTAGCTAGGGG - Intronic
1071781545 10:88851773-88851795 TGTGCTGCTGCCTGAGCTGCTGG - Exonic
1073609461 10:104928824-104928846 AGTGCTGCAGCCCTATGTCGAGG + Intronic
1075566238 10:123506491-123506513 TGTGATGCAGCCTTAGCTGGCGG - Intergenic
1076817581 10:132922428-132922450 GGTGCTGCAGCCCCAGCATGGGG - Intronic
1077602323 11:3582126-3582148 TGTGCTTCAGCCCCGGCTGGGGG - Intergenic
1077919804 11:6633583-6633605 TGTGGTGCAGCTGGAGATCGGGG - Exonic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1078594475 11:12674645-12674667 TGGGCTGCTGCCCGCGCTCCGGG - Exonic
1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG + Intronic
1084330003 11:68424651-68424673 AGGGCTGAAGCCCGAGATCGAGG + Intronic
1084454334 11:69258972-69258994 TGTGCATCAGACCCAGCTCGAGG - Intergenic
1086953766 11:92915635-92915657 TGGCCAGCAGCGCGAGCTCGTGG - Intergenic
1087307809 11:96505287-96505309 TGTCCTGCAGCCATAGCTCCTGG - Intronic
1089383072 11:118050086-118050108 TGTGCTGGAGCCCCAGCCCTGGG + Intergenic
1090256332 11:125287251-125287273 TGTGGTTCAGCCCGGGCTCTGGG - Intronic
1090482868 11:127083497-127083519 TGTTCTGCAGCCCCTGCTGGTGG + Intergenic
1091395394 12:151329-151351 GGTGCTCCAGCCAGAGCTCCAGG + Intronic
1092082845 12:5732351-5732373 TGTCCTGCAGCCAGAGATCATGG - Intronic
1095434035 12:42167934-42167956 TGGGATGCAGTCAGAGCTCGAGG - Intronic
1100980546 12:100159032-100159054 ACTGCTGCAGACCCAGCTCGTGG - Intergenic
1102346823 12:112166127-112166149 TGTGCTGCACCCAGAGCCCCAGG + Intronic
1102958376 12:117074597-117074619 TGTGGTGCAGCCCGACTTAGGGG - Intronic
1104510715 12:129375098-129375120 TGTACTGCAGCCCAAGTTCCCGG - Intronic
1105799512 13:23891396-23891418 TGTCCTGCAGCTGAAGCTCGGGG - Exonic
1105849534 13:24321639-24321661 TGTCCTGCAGCTGAAGCTCGGGG + Exonic
1106702369 13:32244065-32244087 TGTGCAGCAGCCCCTGCTCCAGG + Exonic
1112586775 13:100725587-100725609 TGTGCTGCAGCCCTGCCTCTTGG + Intergenic
1118849468 14:69573056-69573078 GCTGCTGCTGCCCGCGCTCGGGG + Exonic
1121219453 14:92274831-92274853 AGTGCAGGAGCCCGAGCTCCTGG + Intergenic
1122399716 14:101459303-101459325 TCTGCCGCCGCCCGAGCGCGCGG - Intergenic
1123981826 15:25611949-25611971 AGTGCTGAAGCCCCAGCCCGAGG + Intergenic
1125589401 15:40844860-40844882 GGAGCTGCAGCCCGACCGCGGGG + Exonic
1129030059 15:72611507-72611529 ACTGCTGCAGACCCAGCTCGTGG + Intergenic
1129038284 15:72664255-72664277 ACTGCTGCAGACCCAGCTCGTGG + Intronic
1129207200 15:74044321-74044343 AGTGCTGCAGCCCCACCTCCAGG - Exonic
1129728727 15:77917251-77917273 ACTGCTGCAGACCCAGCTCGTGG - Intergenic
1129839789 15:78736620-78736642 ACTGCTGCAGACCCAGCTCGTGG + Intergenic
1133234430 16:4381327-4381349 TGTCCTGCAGCTTGAGCTCCAGG - Exonic
1136466203 16:30445578-30445600 TGGGCCTCAGCCCGAGCTGGCGG - Exonic
1136637933 16:31537573-31537595 TGAGCTGCGGCCGGAGCTCCTGG - Intergenic
1138515694 16:57534608-57534630 TGTGCTGATGCCCTCGCTCGTGG - Intronic
1138598190 16:58040574-58040596 AGTGCTCCAGCCCCAGCGCGTGG - Exonic
1140481991 16:75266874-75266896 TTTGCCGCAGCCCGGGCTCATGG + Intronic
1142592812 17:1013811-1013833 TGGGCTCCAGCCCGAGCCTGGGG - Intronic
1143036621 17:4003335-4003357 TGTGCTGCAGCCGTGGCTGGGGG + Intergenic
1144464779 17:15488583-15488605 TGTGCAGCAGCCCAAGCTCCTGG + Intronic
1144520020 17:15947083-15947105 TGTGCTGCTGCCCGTGCTGTTGG + Intronic
1147459265 17:40557985-40558007 TGGGCTGCAGCCCAGGCTCCGGG + Intronic
1150224765 17:63518245-63518267 TGTGCTGAAGCCAGGGCTCCAGG - Intronic
1151539915 17:74759572-74759594 GGAGCTGCAGCCTGAGCTGGGGG - Intronic
1151674230 17:75589521-75589543 GGTGCCGCAGCCCGGGCTCACGG - Intergenic
1152908961 17:82986240-82986262 TCTGCGGCAGCCCGACCCCGTGG + Intronic
1160587136 18:79919003-79919025 TCTGCTCCAGCGCGAGGTCGAGG + Intronic
1160919411 19:1512863-1512885 TGGGCTGCAGCCCGGACTGGCGG + Intronic
1161154761 19:2726882-2726904 TGAGCTGCAGCCCTGGCTCTGGG - Intronic
1163314110 19:16531033-16531055 TGTGCTGGTGCCTGGGCTCGAGG + Intronic
1163703935 19:18801380-18801402 ACTGCTGCAGCCCGTGCTCTTGG - Intergenic
1164036953 19:21463878-21463900 CTTGCTCCAGCCAGAGCTCGAGG - Intronic
1164042429 19:21505634-21505656 CTTGCTGCAGCCAGAGCTCCAGG + Exonic
1164596512 19:29533881-29533903 TGAGCTGCAGAGGGAGCTCGGGG + Intronic
925649434 2:6073684-6073706 TGAGCTGCAGGCAGAGCTAGGGG + Intergenic
930022090 2:47007705-47007727 GGTGCTGCAGCCTGAGTGCGGGG + Intronic
932572021 2:72943189-72943211 TGTGCTGCAGAGCCAGCTGGTGG + Exonic
942278019 2:174336633-174336655 TGCACAGCAGCCCGGGCTCGTGG + Exonic
946067196 2:216998076-216998098 TGTTCTGCAGGCAGAGTTCGAGG - Intergenic
1175429313 20:58891108-58891130 CGGGCTGCTGCCCGAGCCCGGGG + Intronic
1181345447 22:22216758-22216780 TGTGCTGCACCCTGAGCAGGAGG + Intergenic
1181349553 22:22245208-22245230 TGAGCTGCAGCCTGAGGACGAGG + Exonic
1181573633 22:23780896-23780918 TGTGCTGCAGCCCCAGCACGTGG - Exonic
1181974413 22:26718601-26718623 TGTGCTATCACCCGAGCTCGAGG - Intergenic
1184464174 22:44659309-44659331 TGTGCTGAAGCCAGAGCCAGCGG + Intergenic
1184856782 22:47150682-47150704 TGGGCTGCAGCGCTAGCTCAAGG + Intronic
1185302571 22:50090160-50090182 GCAGCTGGAGCCCGAGCTCGCGG + Exonic
952904992 3:38133983-38134005 TGTGCTGCAGCCTGGGGCCGGGG - Exonic
961018244 3:123483371-123483393 GGTGCTGCAGCCTGGGCTCCAGG + Intergenic
966029930 3:175333385-175333407 TGTGCTTCAGCCCCAGGTGGTGG + Intronic
967633407 3:191773833-191773855 TGTGCTCCAACCTGAGCTGGAGG - Intergenic
968064732 3:195752347-195752369 AGTGCTGCAGGCCGCGCTCTGGG - Intronic
986286475 5:6362823-6362845 TGTGCTGCAGCCTGTGGTCCCGG - Intergenic
992150648 5:73899335-73899357 TCTGCAGCTGCCCGAGCCCGCGG + Intronic
997402010 5:133611153-133611175 TGTCCAGCAGCCCTCGCTCGCGG - Intronic
1000903568 5:166936535-166936557 TGTGGGGCAGCACGAGTTCGGGG - Intergenic
1001095786 5:168774490-168774512 TGTTCTGCAGCAGGAGCTCAAGG - Intronic
1001851187 5:174967800-174967822 TGTGCTGCAGCCCAAGAATGTGG + Intergenic
1002322306 5:178383152-178383174 TGGGCTGCACCCAGAGCTGGAGG - Intronic
1003325366 6:5086280-5086302 TGAGCTGCAGCCCGAGCCGCTGG + Exonic
1003845487 6:10169666-10169688 AGTGCTGCAATCCTAGCTCGCGG - Intronic
1005639828 6:27785360-27785382 TGGGCTGCAGCCCGAGAGGGTGG + Intergenic
1005958196 6:30679209-30679231 GCTGCTGCAGCCAGAGCTCCAGG - Exonic
1005971657 6:30766549-30766571 TGAGCTTCAGCCTGAGCTCATGG + Intergenic
1006834030 6:36986085-36986107 GGAGCTGGAGCCGGAGCTCGCGG - Exonic
1007969405 6:46035708-46035730 TGTGTTGCAGCCAGAGCTGGTGG + Intronic
1009534241 6:64860591-64860613 GGTGTTGCAGCCCTAGCTTGGGG + Intronic
1013231362 6:108164748-108164770 TGTGCGAGACCCCGAGCTCGAGG + Intronic
1019917011 7:4140110-4140132 TCTGCAGCAGCCAGAGCACGAGG - Intronic
1022793618 7:33714388-33714410 TCTGCTGCAGCCCTAGCACTGGG + Intergenic
1025996418 7:66530197-66530219 TGTTCTGCAGCCTGAGCCTGGGG + Intergenic
1026020057 7:66699160-66699182 GGTGCTCAAGCCAGAGCTCGGGG - Intronic
1030300836 7:107973059-107973081 TGTTCTGCAGCCAGAGCACTGGG - Exonic
1034895194 7:154872045-154872067 TATGCTGCAGCCACAGCTAGGGG - Intronic
1035223211 7:157418916-157418938 TGTGCTGCAGATAGAGCCCGCGG + Intergenic
1036259563 8:7229065-7229087 TGTGCCTCAGCCCCAGCTGGGGG - Intergenic
1036307057 8:7610459-7610481 TGTGCCTCAGCCCCAGCTGGGGG + Intergenic
1036311606 8:7687635-7687657 TGTGCGTCAGCCCCAGCTGGGGG - Intergenic
1036357904 8:8058446-8058468 TGTGCCTCAGCCCCAGCTGGGGG + Intergenic
1036762299 8:11517782-11517804 GGTGCTGCAGGCCAAGCTCTTGG + Intronic
1036783440 8:11667575-11667597 TGTACTACAGCCTGAGCTCCTGG - Intergenic
1036830457 8:12016039-12016061 TGTGCCTCAGCCCCAGCTGGAGG - Intergenic
1038164757 8:25074800-25074822 TGTGCTCCAGCCTGAGCAAGAGG - Intergenic
1040604880 8:48921741-48921763 TGTGGTGCAGCGCCAGCGCGCGG + Intergenic
1047252948 8:123194270-123194292 TGTGATGCAGCTCCAGCTCCGGG - Intronic
1048183578 8:132218236-132218258 TGTGCTGCACCCCTAGCACCTGG + Intronic
1049573478 8:143380138-143380160 TGTGCTGCCGCAGGAGCTGGAGG + Exonic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049762258 8:144336858-144336880 TGTTCTGCAGCCGGAGCGAGCGG + Intergenic
1060282382 9:122223076-122223098 TGCACTGCAGCCCAAGCTCTGGG - Intronic
1061062850 9:128259241-128259263 ACTGCTGCAGACCCAGCTCGTGG - Exonic
1062677186 9:137753446-137753468 TGTGCTGCAGACAGGGCTCCCGG + Intronic
1190726626 X:53194348-53194370 TGTGCGGCTGCCCGAGGGCGAGG - Exonic
1195692963 X:107644006-107644028 TGTGAAGCAGCCCGTGCTTGGGG - Intronic
1197075644 X:122349958-122349980 TGTACTGCAGCCATAGCTAGAGG + Intergenic
1199851861 X:151729541-151729563 TGTGCTGGAGCCTGAACTCAGGG + Intergenic