ID: 1084030766

View in Genome Browser
Species Human (GRCh38)
Location 11:66479571-66479593
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030766_1084030774 1 Left 1084030766 11:66479571-66479593 CCCAGTCTGACCCTGGGCCCTCA No data
Right 1084030774 11:66479595-66479617 CACTACTCCCCATTTGGCCTAGG No data
1084030766_1084030772 -5 Left 1084030766 11:66479571-66479593 CCCAGTCTGACCCTGGGCCCTCA No data
Right 1084030772 11:66479589-66479611 CCTCACCACTACTCCCCATTTGG No data
1084030766_1084030782 30 Left 1084030766 11:66479571-66479593 CCCAGTCTGACCCTGGGCCCTCA No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030766 Original CRISPR TGAGGGCCCAGGGTCAGACT GGG (reversed) Intergenic
No off target data available for this crispr