ID: 1084030770

View in Genome Browser
Species Human (GRCh38)
Location 11:66479588-66479610
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030770_1084030782 13 Left 1084030770 11:66479588-66479610 CCCTCACCACTACTCCCCATTTG No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030770 Original CRISPR CAAATGGGGAGTAGTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr