ID: 1084030771

View in Genome Browser
Species Human (GRCh38)
Location 11:66479589-66479611
Sequence CCAAATGGGGAGTAGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030771_1084030782 12 Left 1084030771 11:66479589-66479611 CCTCACCACTACTCCCCATTTGG No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030771 Original CRISPR CCAAATGGGGAGTAGTGGTG AGG (reversed) Intergenic
No off target data available for this crispr