ID: 1084030777

View in Genome Browser
Species Human (GRCh38)
Location 11:66479604-66479626
Sequence GCGGAAGGGCCTAGGCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030777_1084030782 -3 Left 1084030777 11:66479604-66479626 CCATTTGGCCTAGGCCCTTCCGC No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030777_1084030791 29 Left 1084030777 11:66479604-66479626 CCATTTGGCCTAGGCCCTTCCGC No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030777 Original CRISPR GCGGAAGGGCCTAGGCCAAA TGG (reversed) Intergenic
No off target data available for this crispr