ID: 1084030781

View in Genome Browser
Species Human (GRCh38)
Location 11:66479623-66479645
Sequence CACGGTCTGGGTGGGGCATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030781_1084030794 17 Left 1084030781 11:66479623-66479645 CCGCATGCCCCACCCAGACCGTG No data
Right 1084030794 11:66479663-66479685 AGACCTGTAAAAGTGGACCGCGG No data
1084030781_1084030795 18 Left 1084030781 11:66479623-66479645 CCGCATGCCCCACCCAGACCGTG No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030781_1084030791 10 Left 1084030781 11:66479623-66479645 CCGCATGCCCCACCCAGACCGTG No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030781 Original CRISPR CACGGTCTGGGTGGGGCATG CGG (reversed) Intergenic