ID: 1084030782

View in Genome Browser
Species Human (GRCh38)
Location 11:66479624-66479646
Sequence CGCATGCCCCACCCAGACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030768_1084030782 20 Left 1084030768 11:66479581-66479603 CCCTGGGCCCTCACCACTACTCC No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030769_1084030782 19 Left 1084030769 11:66479582-66479604 CCTGGGCCCTCACCACTACTCCC No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030776_1084030782 -2 Left 1084030776 11:66479603-66479625 CCCATTTGGCCTAGGCCCTTCCG No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030766_1084030782 30 Left 1084030766 11:66479571-66479593 CCCAGTCTGACCCTGGGCCCTCA No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030775_1084030782 -1 Left 1084030775 11:66479602-66479624 CCCCATTTGGCCTAGGCCCTTCC No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030767_1084030782 29 Left 1084030767 11:66479572-66479594 CCAGTCTGACCCTGGGCCCTCAC No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030771_1084030782 12 Left 1084030771 11:66479589-66479611 CCTCACCACTACTCCCCATTTGG No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030770_1084030782 13 Left 1084030770 11:66479588-66479610 CCCTCACCACTACTCCCCATTTG No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030777_1084030782 -3 Left 1084030777 11:66479604-66479626 CCATTTGGCCTAGGCCCTTCCGC No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data
1084030773_1084030782 7 Left 1084030773 11:66479594-66479616 CCACTACTCCCCATTTGGCCTAG No data
Right 1084030782 11:66479624-66479646 CGCATGCCCCACCCAGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030782 Original CRISPR CGCATGCCCCACCCAGACCG TGG Intergenic
No off target data available for this crispr