ID: 1084030783

View in Genome Browser
Species Human (GRCh38)
Location 11:66479630-66479652
Sequence ACGGGACCACGGTCTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030783_1084030794 10 Left 1084030783 11:66479630-66479652 CCCCACCCAGACCGTGGTCCCGT No data
Right 1084030794 11:66479663-66479685 AGACCTGTAAAAGTGGACCGCGG No data
1084030783_1084030791 3 Left 1084030783 11:66479630-66479652 CCCCACCCAGACCGTGGTCCCGT No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030783_1084030795 11 Left 1084030783 11:66479630-66479652 CCCCACCCAGACCGTGGTCCCGT No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030783_1084030798 27 Left 1084030783 11:66479630-66479652 CCCCACCCAGACCGTGGTCCCGT No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030783 Original CRISPR ACGGGACCACGGTCTGGGTG GGG (reversed) Intergenic
No off target data available for this crispr