ID: 1084030786 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:66479635-66479657 |
| Sequence | GACTCACGGGACCACGGTCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1084030786_1084030798 | 22 | Left | 1084030786 | 11:66479635-66479657 | CCCAGACCGTGGTCCCGTGAGTC | No data | ||
| Right | 1084030798 | 11:66479680-66479702 | CCGCGGGCCCGCCTCTGCTCTGG | No data | ||||
| 1084030786_1084030795 | 6 | Left | 1084030786 | 11:66479635-66479657 | CCCAGACCGTGGTCCCGTGAGTC | No data | ||
| Right | 1084030795 | 11:66479664-66479686 | GACCTGTAAAAGTGGACCGCGGG | No data | ||||
| 1084030786_1084030791 | -2 | Left | 1084030786 | 11:66479635-66479657 | CCCAGACCGTGGTCCCGTGAGTC | No data | ||
| Right | 1084030791 | 11:66479656-66479678 | TCCGTCCAGACCTGTAAAAGTGG | No data | ||||
| 1084030786_1084030794 | 5 | Left | 1084030786 | 11:66479635-66479657 | CCCAGACCGTGGTCCCGTGAGTC | No data | ||
| Right | 1084030794 | 11:66479663-66479685 | AGACCTGTAAAAGTGGACCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1084030786 | Original CRISPR | GACTCACGGGACCACGGTCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||