ID: 1084030787

View in Genome Browser
Species Human (GRCh38)
Location 11:66479636-66479658
Sequence GGACTCACGGGACCACGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030787_1084030795 5 Left 1084030787 11:66479636-66479658 CCAGACCGTGGTCCCGTGAGTCC No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030787_1084030798 21 Left 1084030787 11:66479636-66479658 CCAGACCGTGGTCCCGTGAGTCC No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030787_1084030791 -3 Left 1084030787 11:66479636-66479658 CCAGACCGTGGTCCCGTGAGTCC No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030787_1084030794 4 Left 1084030787 11:66479636-66479658 CCAGACCGTGGTCCCGTGAGTCC No data
Right 1084030794 11:66479663-66479685 AGACCTGTAAAAGTGGACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030787 Original CRISPR GGACTCACGGGACCACGGTC TGG (reversed) Intergenic
No off target data available for this crispr