ID: 1084030788

View in Genome Browser
Species Human (GRCh38)
Location 11:66479641-66479663
Sequence TGGACGGACTCACGGGACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030788_1084030791 -8 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030788_1084030802 28 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030788_1084030795 0 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030788_1084030798 16 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030788_1084030803 29 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030803 11:66479693-66479715 TCTGCTCTGGACTCCCTTTCGGG No data
1084030788_1084030794 -1 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030794 11:66479663-66479685 AGACCTGTAAAAGTGGACCGCGG No data
1084030788_1084030804 30 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030788 Original CRISPR TGGACGGACTCACGGGACCA CGG (reversed) Intergenic
No off target data available for this crispr