ID: 1084030790

View in Genome Browser
Species Human (GRCh38)
Location 11:66479649-66479671
Sequence TACAGGTCTGGACGGACTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030790_1084030798 8 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030790_1084030803 21 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030803 11:66479693-66479715 TCTGCTCTGGACTCCCTTTCGGG No data
1084030790_1084030804 22 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030790_1084030795 -8 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030790_1084030794 -9 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030794 11:66479663-66479685 AGACCTGTAAAAGTGGACCGCGG No data
1084030790_1084030802 20 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030790_1084030805 29 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030790 Original CRISPR TACAGGTCTGGACGGACTCA CGG (reversed) Intergenic
No off target data available for this crispr