ID: 1084030791

View in Genome Browser
Species Human (GRCh38)
Location 11:66479656-66479678
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030785_1084030791 1 Left 1084030785 11:66479632-66479654 CCACCCAGACCGTGGTCCCGTGA No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030777_1084030791 29 Left 1084030777 11:66479604-66479626 CCATTTGGCCTAGGCCCTTCCGC No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030786_1084030791 -2 Left 1084030786 11:66479635-66479657 CCCAGACCGTGGTCCCGTGAGTC No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030783_1084030791 3 Left 1084030783 11:66479630-66479652 CCCCACCCAGACCGTGGTCCCGT No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030781_1084030791 10 Left 1084030781 11:66479623-66479645 CCGCATGCCCCACCCAGACCGTG No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030776_1084030791 30 Left 1084030776 11:66479603-66479625 CCCATTTGGCCTAGGCCCTTCCG No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030779_1084030791 15 Left 1084030779 11:66479618-66479640 CCCTTCCGCATGCCCCACCCAGA No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030787_1084030791 -3 Left 1084030787 11:66479636-66479658 CCAGACCGTGGTCCCGTGAGTCC No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030788_1084030791 -8 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030778_1084030791 21 Left 1084030778 11:66479612-66479634 CCTAGGCCCTTCCGCATGCCCCA No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030780_1084030791 14 Left 1084030780 11:66479619-66479641 CCTTCCGCATGCCCCACCCAGAC No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data
1084030784_1084030791 2 Left 1084030784 11:66479631-66479653 CCCACCCAGACCGTGGTCCCGTG No data
Right 1084030791 11:66479656-66479678 TCCGTCCAGACCTGTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030791 Original CRISPR TCCGTCCAGACCTGTAAAAG TGG Intergenic