ID: 1084030795

View in Genome Browser
Species Human (GRCh38)
Location 11:66479664-66479686
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030778_1084030795 29 Left 1084030778 11:66479612-66479634 CCTAGGCCCTTCCGCATGCCCCA No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030787_1084030795 5 Left 1084030787 11:66479636-66479658 CCAGACCGTGGTCCCGTGAGTCC No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030788_1084030795 0 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030780_1084030795 22 Left 1084030780 11:66479619-66479641 CCTTCCGCATGCCCCACCCAGAC No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030785_1084030795 9 Left 1084030785 11:66479632-66479654 CCACCCAGACCGTGGTCCCGTGA No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030790_1084030795 -8 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030783_1084030795 11 Left 1084030783 11:66479630-66479652 CCCCACCCAGACCGTGGTCCCGT No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030784_1084030795 10 Left 1084030784 11:66479631-66479653 CCCACCCAGACCGTGGTCCCGTG No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030789_1084030795 -7 Left 1084030789 11:66479648-66479670 CCCGTGAGTCCGTCCAGACCTGT No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030781_1084030795 18 Left 1084030781 11:66479623-66479645 CCGCATGCCCCACCCAGACCGTG No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030779_1084030795 23 Left 1084030779 11:66479618-66479640 CCCTTCCGCATGCCCCACCCAGA No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data
1084030786_1084030795 6 Left 1084030786 11:66479635-66479657 CCCAGACCGTGGTCCCGTGAGTC No data
Right 1084030795 11:66479664-66479686 GACCTGTAAAAGTGGACCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030795 Original CRISPR GACCTGTAAAAGTGGACCGC GGG Intergenic