ID: 1084030796

View in Genome Browser
Species Human (GRCh38)
Location 11:66479666-66479688
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030796_1084030804 5 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030796_1084030806 15 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030796_1084030805 12 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030796_1084030798 -9 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030796_1084030802 3 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030796_1084030803 4 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030803 11:66479693-66479715 TCTGCTCTGGACTCCCTTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030796 Original CRISPR GGCCCGCGGTCCACTTTTAC AGG (reversed) Intergenic
No off target data available for this crispr