ID: 1084030797

View in Genome Browser
Species Human (GRCh38)
Location 11:66479680-66479702
Sequence CCAGAGCAGAGGCGGGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030797_1084030803 -10 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030803 11:66479693-66479715 TCTGCTCTGGACTCCCTTTCGGG No data
1084030797_1084030804 -9 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030797_1084030806 1 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030797_1084030811 25 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030811 11:66479728-66479750 TTTCTCATCCATCAGGCATCTGG No data
1084030797_1084030810 18 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data
1084030797_1084030805 -2 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030797 Original CRISPR CCAGAGCAGAGGCGGGCCCG CGG (reversed) Intergenic
No off target data available for this crispr