ID: 1084030798

View in Genome Browser
Species Human (GRCh38)
Location 11:66479680-66479702
Sequence CCGCGGGCCCGCCTCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030792_1084030798 0 Left 1084030792 11:66479657-66479679 CCGTCCAGACCTGTAAAAGTGGA No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030793_1084030798 -4 Left 1084030793 11:66479661-66479683 CCAGACCTGTAAAAGTGGACCGC No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030783_1084030798 27 Left 1084030783 11:66479630-66479652 CCCCACCCAGACCGTGGTCCCGT No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030790_1084030798 8 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030796_1084030798 -9 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030788_1084030798 16 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030785_1084030798 25 Left 1084030785 11:66479632-66479654 CCACCCAGACCGTGGTCCCGTGA No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030784_1084030798 26 Left 1084030784 11:66479631-66479653 CCCACCCAGACCGTGGTCCCGTG No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030787_1084030798 21 Left 1084030787 11:66479636-66479658 CCAGACCGTGGTCCCGTGAGTCC No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030789_1084030798 9 Left 1084030789 11:66479648-66479670 CCCGTGAGTCCGTCCAGACCTGT No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
1084030786_1084030798 22 Left 1084030786 11:66479635-66479657 CCCAGACCGTGGTCCCGTGAGTC No data
Right 1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030798 Original CRISPR CCGCGGGCCCGCCTCTGCTC TGG Intergenic
No off target data available for this crispr