ID: 1084030799

View in Genome Browser
Species Human (GRCh38)
Location 11:66479687-66479709
Sequence AGGGAGTCCAGAGCAGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030799_1084030813 29 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030813 11:66479739-66479761 TCAGGCATCTGGCAAGCACCAGG No data
1084030799_1084030805 -9 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030799_1084030810 11 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data
1084030799_1084030811 18 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030811 11:66479728-66479750 TTTCTCATCCATCAGGCATCTGG No data
1084030799_1084030806 -6 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030799 Original CRISPR AGGGAGTCCAGAGCAGAGGC GGG (reversed) Intergenic
No off target data available for this crispr