ID: 1084030802

View in Genome Browser
Species Human (GRCh38)
Location 11:66479692-66479714
Sequence CTCTGCTCTGGACTCCCTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030790_1084030802 20 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030796_1084030802 3 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030792_1084030802 12 Left 1084030792 11:66479657-66479679 CCGTCCAGACCTGTAAAAGTGGA No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030793_1084030802 8 Left 1084030793 11:66479661-66479683 CCAGACCTGTAAAAGTGGACCGC No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030789_1084030802 21 Left 1084030789 11:66479648-66479670 CCCGTGAGTCCGTCCAGACCTGT No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data
1084030788_1084030802 28 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030802 11:66479692-66479714 CTCTGCTCTGGACTCCCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030802 Original CRISPR CTCTGCTCTGGACTCCCTTT CGG Intergenic
No off target data available for this crispr