ID: 1084030804

View in Genome Browser
Species Human (GRCh38)
Location 11:66479694-66479716
Sequence CTGCTCTGGACTCCCTTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030790_1084030804 22 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030793_1084030804 10 Left 1084030793 11:66479661-66479683 CCAGACCTGTAAAAGTGGACCGC No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030797_1084030804 -9 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030792_1084030804 14 Left 1084030792 11:66479657-66479679 CCGTCCAGACCTGTAAAAGTGGA No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030788_1084030804 30 Left 1084030788 11:66479641-66479663 CCGTGGTCCCGTGAGTCCGTCCA No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030789_1084030804 23 Left 1084030789 11:66479648-66479670 CCCGTGAGTCCGTCCAGACCTGT No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data
1084030796_1084030804 5 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030804 11:66479694-66479716 CTGCTCTGGACTCCCTTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030804 Original CRISPR CTGCTCTGGACTCCCTTTCG GGG Intergenic
No off target data available for this crispr