ID: 1084030805

View in Genome Browser
Species Human (GRCh38)
Location 11:66479701-66479723
Sequence GGACTCCCTTTCGGGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030790_1084030805 29 Left 1084030790 11:66479649-66479671 CCGTGAGTCCGTCCAGACCTGTA No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030797_1084030805 -2 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030792_1084030805 21 Left 1084030792 11:66479657-66479679 CCGTCCAGACCTGTAAAAGTGGA No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030800_1084030805 -10 Left 1084030800 11:66479688-66479710 CCGCCTCTGCTCTGGACTCCCTT No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030793_1084030805 17 Left 1084030793 11:66479661-66479683 CCAGACCTGTAAAAGTGGACCGC No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030796_1084030805 12 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030799_1084030805 -9 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data
1084030789_1084030805 30 Left 1084030789 11:66479648-66479670 CCCGTGAGTCCGTCCAGACCTGT No data
Right 1084030805 11:66479701-66479723 GGACTCCCTTTCGGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030805 Original CRISPR GGACTCCCTTTCGGGGCCGC AGG Intergenic
No off target data available for this crispr