ID: 1084030806

View in Genome Browser
Species Human (GRCh38)
Location 11:66479704-66479726
Sequence CTCCCTTTCGGGGCCGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030800_1084030806 -7 Left 1084030800 11:66479688-66479710 CCGCCTCTGCTCTGGACTCCCTT No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030801_1084030806 -10 Left 1084030801 11:66479691-66479713 CCTCTGCTCTGGACTCCCTTTCG No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030792_1084030806 24 Left 1084030792 11:66479657-66479679 CCGTCCAGACCTGTAAAAGTGGA No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030797_1084030806 1 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030793_1084030806 20 Left 1084030793 11:66479661-66479683 CCAGACCTGTAAAAGTGGACCGC No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030796_1084030806 15 Left 1084030796 11:66479666-66479688 CCTGTAAAAGTGGACCGCGGGCC No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data
1084030799_1084030806 -6 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030806 11:66479704-66479726 CTCCCTTTCGGGGCCGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030806 Original CRISPR CTCCCTTTCGGGGCCGCAGG AGG Intergenic
No off target data available for this crispr