ID: 1084030810

View in Genome Browser
Species Human (GRCh38)
Location 11:66479721-66479743
Sequence AGGAGGCTTTCTCATCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084030807_1084030810 -8 Left 1084030807 11:66479706-66479728 CCCTTTCGGGGCCGCAGGAGGCT No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data
1084030800_1084030810 10 Left 1084030800 11:66479688-66479710 CCGCCTCTGCTCTGGACTCCCTT No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data
1084030797_1084030810 18 Left 1084030797 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data
1084030799_1084030810 11 Left 1084030799 11:66479687-66479709 CCCGCCTCTGCTCTGGACTCCCT No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data
1084030808_1084030810 -9 Left 1084030808 11:66479707-66479729 CCTTTCGGGGCCGCAGGAGGCTT No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data
1084030801_1084030810 7 Left 1084030801 11:66479691-66479713 CCTCTGCTCTGGACTCCCTTTCG No data
Right 1084030810 11:66479721-66479743 AGGAGGCTTTCTCATCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084030810 Original CRISPR AGGAGGCTTTCTCATCCATC AGG Intergenic
No off target data available for this crispr