ID: 1084032271

View in Genome Browser
Species Human (GRCh38)
Location 11:66487934-66487956
Sequence CATCGACCTCTTTGAAGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084032271_1084032276 6 Left 1084032271 11:66487934-66487956 CCGGCTCTTCAAAGAGGTCGATG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1084032276 11:66487963-66487985 GGAAGCCCTACTACGAGGTGCGG 0: 1
1: 0
2: 1
3: 2
4: 55
1084032271_1084032275 1 Left 1084032271 11:66487934-66487956 CCGGCTCTTCAAAGAGGTCGATG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1084032275 11:66487958-66487980 AGAAGGGAAGCCCTACTACGAGG 0: 1
1: 1
2: 1
3: 6
4: 59
1084032271_1084032281 29 Left 1084032271 11:66487934-66487956 CCGGCTCTTCAAAGAGGTCGATG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1084032281 11:66487986-66488008 CTGGCTTCTGTGCTTGGCTCAGG 0: 1
1: 0
2: 2
3: 45
4: 404
1084032271_1084032277 10 Left 1084032271 11:66487934-66487956 CCGGCTCTTCAAAGAGGTCGATG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1084032277 11:66487967-66487989 GCCCTACTACGAGGTGCGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 28
1084032271_1084032280 23 Left 1084032271 11:66487934-66487956 CCGGCTCTTCAAAGAGGTCGATG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1084032280 11:66487980-66488002 GTGCGGCTGGCTTCTGTGCTTGG 0: 1
1: 1
2: 1
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084032271 Original CRISPR CATCGACCTCTTTGAAGAGC CGG (reversed) Exonic
900403719 1:2483446-2483468 TCTGGAACTCTTTGAAGAGCAGG + Intronic
900407431 1:2498746-2498768 CATCGACCCCTTTGTGGAGGTGG + Exonic
911888408 1:103334158-103334180 CATTAACATCTTTGATGAGCAGG - Intergenic
914931601 1:151939157-151939179 CATGGACATCTTTGCAGGGCAGG + Intergenic
918787425 1:188780656-188780678 CATAGACCTCTTAGAAGATAGGG - Intergenic
920966728 1:210707270-210707292 CAGGGACCTCATTGCAGAGCTGG - Intronic
1071292308 10:84196620-84196642 CATCACCCTGGTTGAAGAGCTGG + Exonic
1075008155 10:118845244-118845266 CATGGCTCTCTTTGAAGAGGAGG + Intergenic
1084032271 11:66487934-66487956 CATCGACCTCTTTGAAGAGCCGG - Exonic
1086869815 11:92023939-92023961 CATCAAGCTCTTTTAAGAGCAGG - Intergenic
1087408561 11:97761435-97761457 CATCCCCCACTTTGGAGAGCTGG + Intergenic
1088774590 11:113070038-113070060 CATCAGCCTATTTGAAGAGAGGG + Intronic
1095670156 12:44849216-44849238 CATGGATTTCTTTGATGAGCAGG - Intronic
1103036506 12:117661154-117661176 CTTTGGCCTCTTTGAAGAGGAGG - Intronic
1107727809 13:43317493-43317515 CATTGATTTCTTTGAATAGCAGG - Intronic
1108681520 13:52784779-52784801 CATGGACCTTTTTGTGGAGCAGG + Intergenic
1111717976 13:91904650-91904672 CATCTACCTCTTGGAGGACCTGG - Intronic
1118451135 14:65903498-65903520 CATGGACATCTTTGAGGAGTGGG - Intergenic
1119073756 14:71615091-71615113 CATAGACATCTTTGAAAAGAGGG - Intronic
1119226134 14:72945901-72945923 CATCGTTCACTGTGAAGAGCCGG - Exonic
1120202447 14:81552796-81552818 CATGAACCTCTTTGAGGAGGAGG - Intergenic
1123738453 15:23210062-23210084 CATCTACCTCTTGGAGGACCTGG - Intergenic
1124289663 15:28438726-28438748 CATCTACCTCTTGGAGGACCTGG - Intergenic
1124293558 15:28478585-28478607 CATCTACCTCTTGGAGGACCTGG + Intergenic
1126201501 15:45991969-45991991 CATCGACCTGCTTGCAGAGGAGG - Intergenic
1129802289 15:78424303-78424325 CATGGACATCTTTGGAGAGGTGG - Intergenic
1131040535 15:89261338-89261360 CATATATCTCTTTGAAGAGCTGG + Intronic
1136709014 16:32217923-32217945 CATCTACCTCTTGGAGGACCTGG + Intergenic
1136758895 16:32711501-32711523 CATCTACCTCTTGGAGGACCTGG - Intergenic
1136809212 16:33158883-33158905 CATCTACCTCTTGGAGGACCTGG + Intergenic
1136815688 16:33268963-33268985 CATCTACCTCTTGGAGGACCTGG + Intronic
1138254081 16:55537605-55537627 CTTCTACCTTTGTGAAGAGCTGG - Exonic
1140510546 16:75504608-75504630 CGTCGAGTTCTTTGAAGAGGGGG - Intergenic
1141173000 16:81702809-81702831 CAGCTACCTCCTGGAAGAGCTGG - Intronic
1203061051 16_KI270728v1_random:971826-971848 CATCTACCTCTTGGAGGACCTGG - Intergenic
1143930401 17:10417358-10417380 CATCGACTTCCCTGAAGAGAAGG - Intronic
1151329471 17:73398366-73398388 CATCGGGCTCATTGGAGAGCTGG + Exonic
1152108536 17:78344176-78344198 CATCCACCTGGTTGGAGAGCTGG - Intergenic
1153255021 18:3161883-3161905 CATCGACCCCTTTGACAAGCCGG + Intronic
1155075669 18:22351944-22351966 CCTCGAGCTCTTTGCAAAGCTGG - Intergenic
1163586334 19:18166204-18166226 TATCAAGATCTTTGAAGAGCAGG + Exonic
1164737142 19:30550023-30550045 CATCTCCCTCTTTGGAGAGAAGG - Intronic
1166353768 19:42215200-42215222 CTCTGTCCTCTTTGAAGAGCTGG + Exonic
1167680844 19:50919658-50919680 CATGGACATCTTTGGAGAGGGGG + Intergenic
928061135 2:28114533-28114555 TATTGACCTCTTTGAGGAGTGGG + Intronic
930216227 2:48700191-48700213 GATTGAGCTCTTTGAAGATCTGG + Intronic
930793097 2:55355724-55355746 CATAGAACTCTCTGAAGAGCGGG - Exonic
931443337 2:62306712-62306734 CATCTACCTCTCAGGAGAGCCGG - Intergenic
935196878 2:100821086-100821108 CTTTGACCTTTCTGAAGAGCTGG + Intronic
935509115 2:103949386-103949408 CATGGACATCTTTGAAGGGAAGG - Intergenic
937125261 2:119471304-119471326 CATCGACTTATATGAAGAGAGGG - Intronic
943959042 2:194236154-194236176 TATCAAAATCTTTGAAGAGCTGG + Intergenic
946759764 2:222982053-222982075 CATCGACATCTTTGAACCCCAGG + Intergenic
947557203 2:231104505-231104527 AATTGACCTGTTTAAAGAGCTGG + Intronic
1169080976 20:2797624-2797646 CATGGACCTCTTTTTACAGCAGG - Intronic
1172753564 20:37268117-37268139 CATCGCCCTCATTGAATGGCTGG - Intergenic
1173268836 20:41512926-41512948 CATCCACCACTTTGAAGTCCAGG + Exonic
1173647930 20:44645185-44645207 CTTCCACCTCTGTGAAGAGGAGG - Intronic
1174512313 20:51063028-51063050 CATGGACATTTTTGAAGAACTGG + Intergenic
1179490889 21:41740990-41741012 CATTGACCTGTTCGACGAGCAGG - Exonic
950308942 3:11939223-11939245 CTGTGACCCCTTTGAAGAGCAGG - Intergenic
953968725 3:47330844-47330866 CATCAACCTCCTTGAGTAGCTGG + Intronic
955814847 3:62831094-62831116 CATGGACCTCTTTAAAGTCCTGG + Intronic
956287104 3:67622192-67622214 CATTGACATATTTCAAGAGCTGG - Intronic
957338460 3:78861964-78861986 CATAGACATCTTTGGAGAGCTGG - Intronic
960146765 3:114212169-114212191 AATCTACCTCTGTGAAGAGCAGG + Intergenic
975126963 4:70793830-70793852 CAAAGTCCTGTTTGAAGAGCCGG - Exonic
982152650 4:152478616-152478638 CATCAAACTTTTTGAAGAACTGG + Intronic
983004826 4:162471485-162471507 CATCAATCTCTTTGAAAACCTGG + Intergenic
986424175 5:7613923-7613945 AATATGCCTCTTTGAAGAGCAGG + Intronic
991674128 5:69075280-69075302 CCTCCACCTCTCTGAAAAGCTGG + Intergenic
993220064 5:85083288-85083310 CATCGACCTCTTTGAATCTGTGG + Intergenic
994947617 5:106416031-106416053 CAAAGTCCTGTTTGAAGAGCCGG + Intergenic
998686316 5:144531081-144531103 CTTAAACCTCTTTGAAGAGAAGG - Intergenic
1002060751 5:176624449-176624471 CATTGATCTCTTTCATGAGCAGG - Intronic
1007460147 6:42012063-42012085 CATCAACATTTTTGAAGAGTGGG - Intronic
1010616747 6:78022043-78022065 CATCTGCCACTTTGAACAGCAGG - Intergenic
1010928450 6:81771447-81771469 CATTGACCTCTCTCAGGAGCTGG - Intergenic
1013613195 6:111815018-111815040 AATAGACTTCTTTGAAGAGCTGG + Intronic
1013722309 6:113045219-113045241 CATCGAGCTATTGGAAGAGCAGG - Intergenic
1016953456 6:149603799-149603821 CATCTACCTCTTAGTAAAGCTGG - Intronic
1024969123 7:55052673-55052695 CATCAGCATCTGTGAAGAGCTGG + Intronic
1026574884 7:71563826-71563848 CCTTGACCTCTTTAAAGTGCTGG + Intronic
1027204137 7:76083646-76083668 CCTCAGCCTCTTTGAAGCGCTGG - Intergenic
1035113498 7:156504499-156504521 CGTCGACCTCTCTGAAGCTCTGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1045596305 8:103660104-103660126 CAGTGAGCTCTCTGAAGAGCAGG + Intronic
1047109734 8:121776170-121776192 CATCTACCTATATGGAGAGCTGG - Intergenic
1056070046 9:82976897-82976919 CACGGACCTCTTTGAAGCCCAGG - Intergenic
1056822714 9:89854763-89854785 CAGGGACCCCTTTGCAGAGCTGG - Intergenic
1061649063 9:132031554-132031576 CTTCAACCTCTCTGAATAGCTGG - Intronic
1188172406 X:26943671-26943693 CATCGCCATCTGTGAAGAGCAGG + Intergenic
1188185775 X:27112704-27112726 CATGGACTTCTTTGATGGGCTGG - Intergenic
1192986793 X:76408468-76408490 TATCTACCTCTTTGGAGACCTGG + Intergenic
1195968978 X:110454061-110454083 CTGCTACCTCTTAGAAGAGCAGG + Exonic
1196795125 X:119496057-119496079 AATCCAGCCCTTTGAAGAGCAGG - Intergenic
1197759437 X:130017105-130017127 CATAGACCATTTTGAAAAGCTGG + Intronic
1198474638 X:136983612-136983634 CCTCCACTTGTTTGAAGAGCAGG - Intergenic