ID: 1084035916

View in Genome Browser
Species Human (GRCh38)
Location 11:66510355-66510377
Sequence TGCTGCTCATAAATGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084035912_1084035916 16 Left 1084035912 11:66510316-66510338 CCGGGTAACCATGAAGATGGAGA 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1084035916 11:66510355-66510377 TGCTGCTCATAAATGCTAGAAGG 0: 1
1: 0
2: 1
3: 8
4: 244
1084035910_1084035916 25 Left 1084035910 11:66510307-66510329 CCTTTTCAACCGGGTAACCATGA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1084035916 11:66510355-66510377 TGCTGCTCATAAATGCTAGAAGG 0: 1
1: 0
2: 1
3: 8
4: 244
1084035915_1084035916 8 Left 1084035915 11:66510324-66510346 CCATGAAGATGGAGACAGGAGGA 0: 1
1: 0
2: 2
3: 44
4: 475
Right 1084035916 11:66510355-66510377 TGCTGCTCATAAATGCTAGAAGG 0: 1
1: 0
2: 1
3: 8
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084035916 Original CRISPR TGCTGCTCATAAATGCTAGA AGG Intronic
907626317 1:56033613-56033635 TCCTGCCCATAAATGGTACAAGG + Intergenic
908356929 1:63330814-63330836 TTGTGCTCAGCAATGCTAGACGG - Intergenic
911635340 1:100229051-100229073 TGTTGCTTCTAAAAGCTAGAAGG - Intronic
912497549 1:110101320-110101342 TGCAGCTCATAACTCCAAGAGGG - Intergenic
912986053 1:114432327-114432349 TGTTTCTCAGAAATGATAGATGG - Intronic
913722377 1:121610840-121610862 ATCTTCTCATAAAAGCTAGATGG - Intergenic
913722502 1:121612541-121612563 ATCTTCTCATAAAAGCTAGATGG - Intergenic
913733340 1:121741733-121741755 ATCTGCTCATAAAAGCTACATGG - Intergenic
913742137 1:121858098-121858120 ATCTTCTCATAAAAGCTAGATGG - Intergenic
913742262 1:121859799-121859821 ATCTTCTCATAAAAGCTAGATGG - Intergenic
913751733 1:121975298-121975320 ATCTTCTCATAAAAGCTAGATGG - Intergenic
913769194 1:122228859-122228881 ATCTGCTCATAAAAGCTACATGG + Intergenic
913769378 1:122231234-122231256 ATCTGCTCCTAAATGCTACATGG + Intergenic
913769514 1:122233100-122233122 ATCTGCTCATAAAAGCTACATGG + Intergenic
913769649 1:122234967-122234989 ATCTTCTCATAAAAGCTAGATGG + Intergenic
913769924 1:122238784-122238806 ATCTGCTCATAAAAGCTACATGG + Intergenic
913770062 1:122240649-122240671 ATCTGCTCATAAAAGCTACATGG + Intergenic
913770200 1:122242516-122242538 ATCTGCTCATAAAAGCTACATGG + Intergenic
913771045 1:122253714-122253736 ATCTGCTCATAAAAGCTACATGG + Intergenic
913771786 1:122263717-122263739 ATCTGCTCATAAAAGCTACATGG + Intergenic
913772063 1:122267449-122267471 ATCTGCTCATAAAAGCTACATGG + Intergenic
913772203 1:122269314-122269336 ATCTGCTCATAAAAGCTACATGG + Intergenic
913772338 1:122271179-122271201 ATCTGCTCATAAAAGCTACATGG + Intergenic
913773177 1:122282377-122282399 ATCTGCTCATAAAAGCTACATGG + Intergenic
913773455 1:122286108-122286130 ATCTGCTCATAAAAGCTACATGG + Intergenic
913773873 1:122291706-122291728 ATCTGCTCATAAAAGCTACATGG + Intergenic
913774289 1:122297304-122297326 ATCTGCTCATAAAAGCTACATGG + Intergenic
913774573 1:122301036-122301058 ATCTGCTCATAAAAGCTACATGG + Intergenic
913774711 1:122302902-122302924 ATCTGCTCATAAAAGCTACATGG + Intergenic
913774850 1:122304768-122304790 ATCTGCTCATAAAAGCTACATGG + Intergenic
913775126 1:122308500-122308522 ATCTGCTCATAAAAGCTACATGG + Intergenic
913775404 1:122312232-122312254 ATCTGCTCATAAAAGCTACATGG + Intergenic
913775543 1:122314098-122314120 ATCTGCTCATAAAAGCTACATGG + Intergenic
913775680 1:122315964-122315986 ATCTGCTCATAAAAGCTACATGG + Intergenic
913775959 1:122319698-122319720 ATCTGCTCATAAAAGCTACATGG + Intergenic
913776527 1:122327164-122327186 ATCTGCTCATAAAAGCTACATGG + Intergenic
913776669 1:122329030-122329052 ATCTGCTCATAAAAGCTACATGG + Intergenic
913776809 1:122330895-122330917 ATCTGCTCATAAAAGCTACATGG + Intergenic
913777226 1:122336493-122336515 ATCTGCTCATAAAAGCTACAGGG + Intergenic
913777784 1:122343946-122343968 ATCTGCTCATAAAAGCTACATGG + Intergenic
913777922 1:122345812-122345834 ATCTGCTCATAAAAGCTACAGGG + Intergenic
913778206 1:122349540-122349562 ATCTGCTCATAAAAGCTACATGG + Intergenic
913778628 1:122355137-122355159 ATCTGCTCATAAAAGCTACATGG + Intergenic
913778765 1:122357002-122357024 ATCTGCTCATAAAAGCTACATGG + Intergenic
913779041 1:122360733-122360755 ATCTGCTCATAAAAGCTACATGG + Intergenic
913779186 1:122362601-122362623 ATCTGCTCATAAAAGCTACATGG + Intergenic
913779466 1:122366333-122366355 ATCTGCTCATAAAAGCTACATGG + Intergenic
913779596 1:122368199-122368221 ATCTGCTCATAAAAGCTACATGG + Intergenic
913780300 1:122377529-122377551 ATCTGCTCATAAAAGCTACATGG + Intergenic
913780858 1:122384993-122385015 ATCTGCTCATAAAAGCTACATGG + Intergenic
913781026 1:122387201-122387223 ATCTACTCATAAAAGCTAGATGG + Intergenic
913781152 1:122388731-122388753 ATCTGCTCATAAAAGCTACATGG + Intergenic
913781290 1:122390597-122390619 ATCTGCTCATAAAAGCTACATGG + Intergenic
913781426 1:122392463-122392485 ATCTGCTCATAAAAGCTACATGG + Intergenic
913781562 1:122394329-122394351 ATCTGCTCATAAAAGCTACATGG + Intergenic
913781700 1:122396195-122396217 ATCTGCTCATAAAAGCTACATGG + Intergenic
913781985 1:122399927-122399949 ATCTGCTCATAAAAGCTACATGG + Intergenic
913782262 1:122403658-122403680 ATCTGCTCATAAAAGCTACATGG + Intergenic
913782406 1:122405525-122405547 ATCTGCTCATAAAAGCTACATGG + Intergenic
913783111 1:122414857-122414879 ATCTGCTCATAAAAGCTACATGG + Intergenic
913783255 1:122416726-122416748 ATCTGCTCATAAAAGCTACATGG + Intergenic
913783525 1:122420457-122420479 ATCTGCTCATAAAAGCTACATGG + Intergenic
913783663 1:122422324-122422346 ATCTGCTCATAAAAGCTACATGG + Intergenic
913784617 1:122435047-122435069 ATCTGCTCATAAAAGCTACATGG + Intergenic
913784894 1:122438778-122438800 ATCTGCTCATAAAAGCTACATGG + Intergenic
913785171 1:122442510-122442532 ATCTGCTCATAAAAGCTACATGG + Intergenic
913785312 1:122444376-122444398 ATCTGCTCATAAAAGCTACATGG + Intergenic
913785595 1:122448110-122448132 ATCTGCTCATAAAAGCTACATGG + Intergenic
913785890 1:122452013-122452035 ATCTGCTCATAAAAGCTACATGG + Intergenic
913786031 1:122453878-122453900 ATCTGCTCATAAAAGCTACATGG + Intergenic
913786304 1:122457610-122457632 ATCTGCTCATAAAAGCTACATGG + Intergenic
913786589 1:122461342-122461364 ATCTGCTCATAAAAGCTACATGG + Intergenic
913786740 1:122463405-122463427 ATCTGCTCATAAAAGCTACATGG + Intergenic
913787149 1:122469003-122469025 ATCTGCTCATAAAAGCTACATGG + Intergenic
913787843 1:122478331-122478353 ATCTGCTCATAAAAGCTACATGG + Intergenic
913788680 1:122489526-122489548 ATCTGCTCATAAAAGCTACATGG + Intergenic
913789098 1:122495123-122495145 ATCTGCTCATAAAAGCTACATGG + Intergenic
913917016 1:124786022-124786044 ATCTACTCATAAAAGCTAGATGG + Intergenic
913917148 1:124787552-124787574 ATCTACTCATAAAAGCTAGATGG + Intergenic
913917285 1:124789082-124789104 ATCTACTCATAAAAGCTAGATGG + Intergenic
913917673 1:124793675-124793697 ATCTACTCATAAAAGCTAGATGG + Intergenic
913917801 1:124795205-124795227 ATCTACTCATAAAAGCTAGATGG + Intergenic
913917929 1:124796737-124796759 ATCTACTCATAAAAGCTAGATGG + Intergenic
913918191 1:124799797-124799819 ATCTACTCATAAAAGCTAGATGG + Intergenic
913918450 1:124802856-124802878 ATCTACTCATAAAAGCTAGATGG + Intergenic
913918587 1:124804386-124804408 ATCTACTCATAAAAGCTAGATGG + Intergenic
913918716 1:124805916-124805938 ATCTACTCATAAAAGCTAGATGG + Intergenic
913918978 1:124808975-124808997 ATCTACTCATAAAAGCTAGATGG + Intergenic
913919112 1:124810506-124810528 ATCTACTCATAAAAGCTAGATGG + Intergenic
913919247 1:124812036-124812058 ATCTACTCATAAAAGCTAGATGG + Intergenic
913919375 1:124813566-124813588 ATCTACTCATAAAAGCTAGATGG + Intergenic
913919646 1:124816627-124816649 ATCTACTCATAAAAGCTAGATGG + Intergenic
913919775 1:124818158-124818180 ATCTACTCATAAAAGCTAGATGG + Intergenic
913919905 1:124819688-124819710 ATCTACTCATAAAAGCTAGATGG + Intergenic
913920035 1:124821218-124821240 ATCTACTCATAAAGGCTAGATGG + Intergenic
913920164 1:124822748-124822770 ATCTACTCATAAAAGCTAGATGG + Intergenic
913920296 1:124824280-124824302 ATCTACTCATAAAAGCTAGATGG + Intergenic
913920433 1:124825811-124825833 ATCTACTCATAAAAGCTAGATGG + Intergenic
913921103 1:124833462-124833484 ATCTACTCATAAAGGCTAGATGG + Intergenic
913921236 1:124834993-124835015 ATCTACTCATAAAAGCTAGATGG + Intergenic
913921760 1:124841116-124841138 ATCTACTCATAAAAGCTAGATGG + Intergenic
913922025 1:124844176-124844198 ATCTACTCATAAAAGCTAGATGG + Intergenic
913922155 1:124845706-124845728 ATCTACTCATAAAAGCTAGATGG + Intergenic
913922286 1:124847236-124847258 ATCTACTCATAAAAGCTAGATGG + Intergenic
913922557 1:124850569-124850591 ATCTACTCATAAAGGCTAGATGG + Intergenic
913923160 1:124858214-124858236 ATCTCCTCATAAAAGCTAGATGG + Intergenic
913923286 1:124859744-124859766 ATCTACTCATAAAAGCTAGATGG + Intergenic
913924379 1:124873515-124873537 ATCTCCTCATAAAAGCTAGATGG + Intergenic
913924749 1:124878102-124878124 ATCTACTCATAAAAGCTAGATGG + Intergenic
913925236 1:124884224-124884246 ATCTCCTCATAAAAGCTAGATGG + Intergenic
913925357 1:124885757-124885779 ATCTACTCATAAAAGCTAGATGG + Intergenic
913925479 1:124887290-124887312 ATCTCCTCATAAAAGCTAGATGG + Intergenic
913926713 1:124902598-124902620 ATCTACTCATAAAAGCTAGATGG + Intergenic
913926950 1:124905658-124905680 ATCTACTCATAAAAGCTAGATGG + Intergenic
913927189 1:124908721-124908743 ATCTACTCATAAAAGCTAGATGG + Intergenic
913927556 1:124913316-124913338 ATCTACTCATAAAAGCTAGATGG + Intergenic
913927682 1:124914845-124914867 ATCTACTCATAAAAGCTAGATGG + Intergenic
913928048 1:124919435-124919457 ATCTACTCATAAAAGCTAGATGG + Intergenic
913928411 1:124924026-124924048 ATCTACTCATAAAAGCTAGATGG + Intergenic
913928534 1:124925560-124925582 ATCTACTCATAAAAGCTAGATGG + Intergenic
913928772 1:124928623-124928645 ATCTACTCATAAAAGCTAGATGG + Intergenic
913929730 1:124940855-124940877 ATCTACTCATAAAAGCTAGATGG - Intergenic
919183680 1:194117774-194117796 TGCTGCTCAAAACCCCTAGAGGG + Intergenic
919471676 1:197987033-197987055 TGCCACTTATAACTGCTAGAAGG + Intergenic
1068159565 10:53246574-53246596 TGCTGTTCAAAAATTCTAGTTGG + Intergenic
1069069269 10:63976979-63977001 TGCTGATCATAAATGCAAGTGGG - Intergenic
1071220469 10:83459309-83459331 TGCTGCTCAAAACTCCTAGCGGG - Intergenic
1078849159 11:15148381-15148403 TGCTGCTCGTGATTGCAAGATGG + Intronic
1084035916 11:66510355-66510377 TGCTGCTCATAAATGCTAGAAGG + Intronic
1086081363 11:82905760-82905782 TGCAGCTGCTAAATGCTAGGTGG - Intronic
1087480944 11:98699583-98699605 TGCTGCTCAGGAAAGCTACATGG - Intergenic
1089276777 11:117342058-117342080 AGCTTCTGATAAATGCAAGAAGG - Intronic
1098137165 12:67414888-67414910 TGCTGGTTAGAAATGCTAGGTGG + Intergenic
1098496852 12:71145858-71145880 TGCTACTCATAATAGCTACAAGG - Intronic
1101805816 12:108062610-108062632 TGCTGCTCATAAAACCTATGTGG - Intergenic
1104225520 12:126828921-126828943 TGCTGTTCATAAGTGTTGGATGG + Intergenic
1105485974 13:20833089-20833111 TGGTGTTCATAAATGCTTAAGGG - Intronic
1105540185 13:21309442-21309464 TGCTGCACATAGAAGCTATAGGG + Intergenic
1108268523 13:48735717-48735739 TGATGCAAATAAATGCAAGAGGG - Intergenic
1110568763 13:76982127-76982149 TGCTGCTCATAAGTGACAGATGG + Intergenic
1113154938 13:107309385-107309407 TTCTGCTTCTAAATGCCAGAGGG + Intronic
1113526606 13:110983941-110983963 TGCTGTAAATAAAGGCTAGATGG - Intergenic
1114345129 14:21786853-21786875 TGCTGTTCATATAAGCTAAACGG + Intergenic
1121938914 14:98048983-98049005 TGCTGAGAATATATGCTAGAGGG + Intergenic
1122088309 14:99322011-99322033 TGAAGCTCAGAAATGTTAGATGG - Intergenic
1130902139 15:88215146-88215168 TCCTGGGCCTAAATGCTAGACGG - Intronic
1138053339 16:53805889-53805911 AGCTGCTCACAAATGCCACACGG - Intronic
1139293450 16:65878573-65878595 TGCTGCCCATGAATGTGAGAGGG + Intergenic
1143726316 17:8849235-8849257 TGCTTCGCAAAAATGCCAGAAGG - Intronic
1144723012 17:17485380-17485402 TGCTGCTTAAAAATCCCAGATGG - Intronic
1150051968 17:61973500-61973522 TGCTCCTCATAAATGTCAAATGG + Intronic
1151072414 17:71230903-71230925 TGCTGCTCACCAAGGCTATATGG - Intergenic
1152650886 17:81492137-81492159 AGCTGCTTATAAATGCCAGGGGG + Intergenic
1154937658 18:21077472-21077494 TGCTGCTCATAAAGGCTACAAGG + Intronic
1155415804 18:25598034-25598056 TGCTCCTCAGCAATGCTAGTAGG + Intergenic
1155460546 18:26077028-26077050 TACAGCTAATAAATGCAAGAGGG + Intronic
1157036015 18:43975191-43975213 TGGTGTTAACAAATGCTAGAGGG - Intergenic
1157120168 18:44901716-44901738 TGCTGCACATAGAAGCTATAGGG + Intronic
1158691158 18:59662080-59662102 TAGTGCTCCTAAATGCAAGAAGG - Intronic
1159340836 18:67130720-67130742 TGCTGCTCTTAAAAACTAAAGGG - Intergenic
1159632438 18:70764445-70764467 TGCTGCCCATGAATGTTAGGGGG - Intergenic
1161339342 19:3732280-3732302 TGATGCACATCAAAGCTAGAGGG - Intronic
925090264 2:1149555-1149577 TGCTGCTCATAGATTCTTGCAGG - Intronic
927283226 2:21329320-21329342 TACTGCTCATTAATGCTAAGTGG - Intergenic
929616091 2:43309233-43309255 TGCTTCTCATGAATGCAAGGTGG + Intronic
929658225 2:43755496-43755518 TCCTTCACACAAATGCTAGAGGG + Intronic
931917357 2:66970632-66970654 TGCTGCTAATAAAATCTGGAGGG - Intergenic
937262599 2:120596036-120596058 ACCTGCTCATACATGCTTGAGGG - Intergenic
937752713 2:125497091-125497113 TGCTGCTCAGAAATGCAAAATGG - Intergenic
938184609 2:129218675-129218697 TGCTTCTTATAAAAGCTACATGG + Intergenic
939881334 2:147634862-147634884 TGCATCTTATAAATGCTATAGGG + Intergenic
941697195 2:168565425-168565447 TGCTGTTCAGAAATACTAAAAGG + Intronic
944235176 2:197435824-197435846 TGTTTCTCTTAAATCCTAGACGG + Intergenic
944265646 2:197722897-197722919 TGCTGCTCATCAATGCAGGTGGG + Intronic
945736681 2:213609532-213609554 TGCTGTTCATGAGTGCAAGAGGG - Intronic
945744366 2:213702392-213702414 TACAGCTCATAAATGCTGCATGG - Intronic
947817666 2:233048861-233048883 TTCTGCCCACAGATGCTAGATGG - Intergenic
1173017451 20:39238497-39238519 TGGTGCTCAGAAATACTTGAGGG + Intergenic
1174842632 20:53914678-53914700 TTCTGCACACAAATGCTTGATGG - Intergenic
1177412856 21:20753165-20753187 TGCTGCTCAAAAAATCTAGATGG + Intergenic
951288112 3:20840270-20840292 TGCTGTACATAAATGATACATGG - Intergenic
953119839 3:40028912-40028934 TGCTTGGAATAAATGCTAGAGGG + Intronic
955195085 3:56797905-56797927 TGCTGATATTAAATGCTGGACGG + Intronic
955468618 3:59262782-59262804 TGCTACTCATAAATTATGGATGG - Intergenic
959485064 3:106918853-106918875 TGCAGCACAGAAATGCAAGATGG + Intergenic
959573593 3:107910768-107910790 TGCTGCACACAAATGACAGAAGG + Intergenic
960836640 3:121913401-121913423 AGCTGCTTATAGATGCTGGAAGG + Intronic
961683355 3:128613544-128613566 CCCAGCTCATCAATGCTAGAAGG + Intergenic
970069768 4:12144421-12144443 TACTGCTAATAAAAGCTAGGTGG - Intergenic
972393070 4:38631585-38631607 TGCTGCTCCTAAATGCTCCCAGG - Intergenic
972480000 4:39487919-39487941 TACAGCTCTTAAATGCTATATGG + Intergenic
974483545 4:62476282-62476304 GGCTGCCCATAAATGCAAGGTGG - Intergenic
975032206 4:69634972-69634994 TCCTGCTGATAAATTTTAGATGG - Intronic
975727363 4:77305114-77305136 TCCTGCACCTAAAGGCTAGAAGG + Intronic
976010305 4:80478644-80478666 TTCTGCACATAAATGGTAGTTGG + Intronic
984482210 4:180319780-180319802 AGCTTCTCAAAAAAGCTAGAAGG + Intergenic
988260331 5:28878339-28878361 TACTGCCCATAATTGCTAGTAGG + Intergenic
990444227 5:55879078-55879100 CACTGCTCATAAAAGCTACAGGG - Intronic
992019858 5:72611924-72611946 TGCTGCTCACAAATGGAAAATGG + Intergenic
992785828 5:80169707-80169729 TTATGCTCATCAAAGCTAGAAGG + Intronic
997055441 5:130438200-130438222 TTCTGCACAGAAATGGTAGAGGG + Intergenic
999064077 5:148666474-148666496 AGCTACTCAGAAATGCTAGATGG - Intronic
999594640 5:153189123-153189145 TTCTGTGCATAAGTGCTAGATGG - Intergenic
1002069234 5:176669226-176669248 TGGTGCTCCTTGATGCTAGAAGG + Intergenic
1004150758 6:13118029-13118051 TGCTGGTCCTAGAAGCTAGATGG + Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1007987722 6:46223969-46223991 TGCTGTTCATAAAGGCTACAAGG + Intronic
1016702600 6:147070323-147070345 TGCTGCTTATAAATGCTCGCTGG + Intergenic
1017837504 6:158192174-158192196 TGCTGCTTATAATTCCTAAATGG - Exonic
1020652222 7:10889493-10889515 TGCTACTAATGGATGCTAGAGGG - Intergenic
1021328688 7:19307295-19307317 TGCTGGTGAAAAATGCCAGATGG - Intergenic
1024184239 7:46932691-46932713 TGCTCATCATAAATGCCAAAGGG + Intergenic
1024926660 7:54622919-54622941 CGCTGTTCATAAAAGCTACAAGG + Intergenic
1025312050 7:57959706-57959728 AGCTGCACATAAATACTTGATGG - Intergenic
1031376651 7:121034829-121034851 TGCTACTCAGAAATGCTCCATGG - Intronic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1038301686 8:26356285-26356307 TGCTGTTCACAAATGCCTGATGG + Intronic
1039494776 8:37972674-37972696 TCCTGGTCATAAATGGAAGAAGG + Intergenic
1039996136 8:42535054-42535076 AGCTGCTCAAAAATCCTCGATGG + Intronic
1043426543 8:80153832-80153854 TGCTGCCCATAGATGCTTGGCGG + Intronic
1044932845 8:97266423-97266445 TCCCTCACATAAATGCTAGAAGG + Intergenic
1045068670 8:98477612-98477634 TGCAGCTCTGAAATGCTTGAGGG + Intronic
1046779635 8:118201319-118201341 TGGTGTTCACTAATGCTAGAGGG - Intronic
1047695599 8:127400808-127400830 AGCTGCTAAAAAATGCTGGAGGG - Intergenic
1049284159 8:141765630-141765652 TGCTAATCAGACATGCTAGATGG + Intergenic
1051478425 9:17533967-17533989 AGCTTCTCAGAAATGCTAAAAGG + Intergenic
1051598776 9:18851385-18851407 TGCTGCTGCTAACAGCTAGATGG - Intronic
1051730727 9:20140009-20140031 TGCTGCTCATTAGTGGTAAATGG + Intergenic
1053564296 9:39232185-39232207 AGCTCTTCATAAATGGTAGATGG + Intronic
1053830080 9:42070086-42070108 AGCTCTTCATAAATGGTAGATGG + Intronic
1054132854 9:61386851-61386873 AGCTCTTCATAAATGGTAGATGG - Intergenic
1054600478 9:67117367-67117389 AGCTCTTCATAAATGGTAGATGG - Intergenic
1055985120 9:82050589-82050611 TTCTGCTCAAAAAAGCAAGAGGG - Intergenic
1059707233 9:116836623-116836645 TGCAGCTCAGAAATGCCAGTAGG - Intronic
1060438546 9:123617193-123617215 TGTTGCTCATAAATCGGAGAGGG - Intronic
1061049521 9:128186158-128186180 TGCTGCTGATAAAGGGTAGCTGG - Intronic
1203338845 Un_KI270302v1:916-938 ATCTCCTCATAAAAGCTAGATGG + Intergenic
1203339213 Un_KI270305v1:383-405 ATCTACTCATAAAAGCTAGATGG + Intergenic
1203339300 Un_KI270305v1:1412-1434 ATCTACTCATAAAAGCTAGATGG + Intergenic
1203339891 Un_KI270320v1:1140-1162 ATCTACTCATAAAAGCTAGATGG + Intergenic
1203340142 Un_KI270320v1:4205-4227 ATCTACTCATAAAAGCTAGATGG + Intergenic
1203339377 Un_KI270322v1:969-991 ATCTACTCATAAAAGCTAGATGG - Intergenic
1203407287 Un_KI270538v1:42008-42030 ATCTTCTCATAAAAGCTAGAGGG + Intergenic
1185990380 X:4888723-4888745 TGCTGCTGATAAATGTAATAGGG - Intergenic
1186404598 X:9290918-9290940 GGCTGCACATGAATGCTATAAGG - Intergenic
1186896755 X:14011465-14011487 GGCTGCTCATAGATGGCAGAGGG - Intronic
1190114579 X:47618369-47618391 GGCAGTTGATAAATGCTAGATGG + Intronic
1191796233 X:65024645-65024667 AGGTGCTCATTAATGGTAGATGG + Intronic
1194083121 X:89492411-89492433 TGTAACTCATAAATGCTTGAGGG - Intergenic
1195442284 X:104912103-104912125 TGCAGCTGATAAAAGATAGAAGG - Intronic
1196789647 X:119452243-119452265 TGCTACCCATTAGTGCTAGAGGG - Intronic
1198650543 X:138859047-138859069 TGCTGCTGCTGAATGCTAGAGGG - Intronic
1199447551 X:147943668-147943690 TGCTGGTCATACTTGCTGGATGG + Intronic
1200435772 Y:3148274-3148296 TGTAACTCATAAATGCTTGAGGG - Intergenic