ID: 1084036084

View in Genome Browser
Species Human (GRCh38)
Location 11:66511202-66511224
Sequence CAGCGCTGGCAGATTTACAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084036080_1084036084 -10 Left 1084036080 11:66511189-66511211 CCCTTTTGTTTTCCAGCGCTGGC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1084036084 11:66511202-66511224 CAGCGCTGGCAGATTTACATGGG 0: 1
1: 0
2: 0
3: 2
4: 65
1084036076_1084036084 19 Left 1084036076 11:66511160-66511182 CCTCTGGGATTCTGAGACTCTGG 0: 1
1: 0
2: 0
3: 36
4: 275
Right 1084036084 11:66511202-66511224 CAGCGCTGGCAGATTTACATGGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084036084 Original CRISPR CAGCGCTGGCAGATTTACAT GGG Exonic
911648716 1:100363016-100363038 AAGCGGTGTCTGATTTACATAGG + Intronic
920641670 1:207757929-207757951 AAGAGTTGGCAGATTTAAATAGG - Intronic
922699986 1:227753631-227753653 CATCGGAGGCAGTTTTACATAGG + Intronic
1062832486 10:615051-615073 CAGCGCTGCCTGTTTCACATGGG - Intronic
1064803114 10:19098884-19098906 AAGCGGTGTCTGATTTACATAGG + Intronic
1079747353 11:24150277-24150299 CAGCACTGGCAGAATGGCATGGG + Intergenic
1083697009 11:64449745-64449767 CAGCTCTGGCAGATATGCAGGGG - Intronic
1084036084 11:66511202-66511224 CAGCGCTGGCAGATTTACATGGG + Exonic
1086052779 11:82613617-82613639 AAGCGGTGTCTGATTTACATAGG - Intergenic
1099804328 12:87498776-87498798 CAGCGATGGAAGTTATACATGGG - Intergenic
1103750327 12:123154191-123154213 CAGAGGTGGCAGATTTGCTTAGG + Intronic
1104611917 12:130235708-130235730 CAGTGCTGGCATATTTTCAGAGG - Intergenic
1110686565 13:78382471-78382493 CAGGGGTGGCAGATGTACACAGG + Intergenic
1112286080 13:98105573-98105595 AAGCGGTGTCTGATTTACATAGG - Intergenic
1115692630 14:35860636-35860658 GAGCCCTGGAAGATTTTCATAGG - Intronic
1116091087 14:40307890-40307912 CAGCACCTGCAGCTTTACATGGG - Intergenic
1120259375 14:82162508-82162530 CAGAGCAGGATGATTTACATTGG + Intergenic
1124860228 15:33432364-33432386 GAGGGCTGGCAGGTTAACATAGG - Intronic
1131909579 15:97182742-97182764 CAGCGATGGCAGGATTCCATGGG - Intergenic
1136643951 16:31592461-31592483 CAGAGATGGGAGAATTACATGGG + Intergenic
1140683443 16:77409532-77409554 CAAGGCTGACAGATTTACAATGG + Intronic
1141413796 16:83854578-83854600 CTGCGGTGTCTGATTTACATAGG + Intergenic
1144750348 17:17644284-17644306 CAGCCCTGGCAGACTAACACAGG + Intergenic
1148889570 17:50798210-50798232 CTGGGCTGGGAGATTTACGTGGG + Intergenic
1155822351 18:30394156-30394178 CAGCACTGGCAAATATACTTTGG + Intergenic
1161101101 19:2422287-2422309 CAGCCCAGGCTGATTAACATGGG - Intronic
1166749340 19:45157339-45157361 CAGGGTTTGCAGATTTAAATCGG - Intronic
925248440 2:2406977-2406999 CAATGCTGGCAGAGATACATGGG + Intergenic
925871766 2:8277987-8278009 CAGCACTTTCAGATTTACAAGGG + Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
928615471 2:33034566-33034588 CAGAGCTGGCACATTTTCAAAGG + Intronic
933627789 2:84621280-84621302 CAGCGATGGCAGCTTTGCACAGG - Exonic
938699725 2:133865413-133865435 CAGCCCTAGCAGACTAACATAGG - Intergenic
942333693 2:174856887-174856909 TAGCTCTGGCAAATTTACAATGG + Intronic
942657690 2:178231181-178231203 CAGCGGTGTCTGATTTACTTAGG + Intronic
948105761 2:235412410-235412432 GTGGGCTGGCAGATTTTCATAGG - Intergenic
1172312008 20:33925754-33925776 CAGGGCTGGCACATGTACCTAGG - Intergenic
1173033323 20:39382299-39382321 CACAGCTGGCAGATTAACTTGGG + Intergenic
1178323010 21:31620306-31620328 AGGCGCTGTCTGATTTACATAGG + Intergenic
1183852859 22:40606112-40606134 GAGAGCTGGCAGATTTGGATAGG - Intronic
1185111206 22:48901237-48901259 CAGCGCTGGGCGGTTTGCATGGG - Intergenic
949306185 3:2643841-2643863 TAGCTCTGGCAGCTTTATATAGG - Intronic
950888894 3:16385753-16385775 CACCTCTGGCAGATTTTCCTTGG + Intronic
956934090 3:74080188-74080210 AGGTGCTGTCAGATTTACATTGG - Intergenic
964923730 3:161930130-161930152 CAGGGCTGGCAGATTACCAGAGG - Intergenic
966711606 3:182978770-182978792 CACCACTGGTAGAATTACATGGG + Intronic
967542046 3:190679481-190679503 CATGGCTGGCACATTTAAATGGG + Intergenic
973658144 4:53072685-53072707 AAGCGGTGTCTGATTTACATAGG - Intronic
976176608 4:82360435-82360457 CAGATCTGGCAGCTTTACATAGG + Intronic
976465400 4:85362649-85362671 AAGTGCTGTCTGATTTACATAGG + Intergenic
992510320 5:77426445-77426467 CAGGGCTGGCAGATGTGCAAAGG - Exonic
1012515238 6:100051659-100051681 CAGGGTTGCCAGATTTACAGAGG - Intergenic
1016041035 6:139432117-139432139 GAGGGCTGTCAGATTTACCTGGG - Intergenic
1021288623 7:18815702-18815724 CAGGGCTGGCAGCTGTGCATAGG + Intronic
1022106102 7:27199242-27199264 CAGGGCTGGTAGCTTTCCATGGG + Exonic
1024094761 7:45974753-45974775 ATGCACTGGCAGATTTCCATGGG + Intergenic
1025146922 7:56513218-56513240 CAGAGCTGGGATATTTAAATCGG - Intergenic
1027296721 7:76781062-76781084 CAGCCCTGGCAGACTAATATAGG + Intergenic
1031515368 7:122692429-122692451 CTTCGCTGGCAGAGTCACATGGG - Intronic
1032336042 7:131025680-131025702 TAGCACTGGTAGTTTTACATAGG - Intergenic
1037505457 8:19525131-19525153 CAGGCCTGGCAGATATATATTGG - Intronic
1042085182 8:65099607-65099629 CAGGGCTGGTAGACTTTCATAGG + Intergenic
1048648961 8:136453453-136453475 CAGTGCTGGCAGAGTTTCTTAGG + Intergenic
1055567825 9:77586668-77586690 CGGCGGTGTCTGATTTACATAGG + Intronic
1189246466 X:39567194-39567216 CAGCTCTGGCAGACTAACACAGG + Intergenic
1191588216 X:62851853-62851875 CAGGGATGGCAATTTTACATGGG + Intergenic
1196760116 X:119193349-119193371 CAGGCCTGGCAGACTTACACAGG - Intergenic
1199000610 X:142632275-142632297 CAGCTCTGGAAGATTTTCATGGG + Intergenic