ID: 1084041539

View in Genome Browser
Species Human (GRCh38)
Location 11:66545809-66545831
Sequence CAGGTTGAGCAGCTGGAAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 417}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084041528_1084041539 24 Left 1084041528 11:66545762-66545784 CCACGGATGCTGGGATCCGAGCG 0: 1
1: 0
2: 2
3: 1
4: 36
Right 1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG 0: 1
1: 0
2: 1
3: 40
4: 417
1084041533_1084041539 -9 Left 1084041533 11:66545795-66545817 CCCACGTTGCCCAGCAGGTTGAG 0: 1
1: 0
2: 1
3: 5
4: 147
Right 1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG 0: 1
1: 0
2: 1
3: 40
4: 417
1084041532_1084041539 -8 Left 1084041532 11:66545794-66545816 CCCCACGTTGCCCAGCAGGTTGA 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG 0: 1
1: 0
2: 1
3: 40
4: 417
1084041534_1084041539 -10 Left 1084041534 11:66545796-66545818 CCACGTTGCCCAGCAGGTTGAGC 0: 1
1: 0
2: 1
3: 14
4: 204
Right 1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG 0: 1
1: 0
2: 1
3: 40
4: 417
1084041530_1084041539 8 Left 1084041530 11:66545778-66545800 CCGAGCGCAGGAAGAGCCCCACG 0: 1
1: 0
2: 3
3: 5
4: 111
Right 1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG 0: 1
1: 0
2: 1
3: 40
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084041539 Original CRISPR CAGGTTGAGCAGCTGGAAGG CGG Exonic
900307867 1:2019732-2019754 CAGGTTCAGCACCAGGACGGCGG - Intronic
900312481 1:2040843-2040865 GAGGTTGGGCAGCTGGGATGTGG - Intergenic
900379397 1:2376406-2376428 GAGGCCGAGCAGGTGGAAGGGGG - Intronic
900814194 1:4830902-4830924 GAGGTCGAGCAGCTGGCAGCTGG - Intergenic
900878500 1:5363662-5363684 CAGGGTGGGCAGGTGGAAAGAGG - Intergenic
901056932 1:6452760-6452782 CAGTATCGGCAGCTGGAAGGCGG - Intronic
901437367 1:9255840-9255862 CCGGCTGAGCTTCTGGAAGGAGG - Intronic
901530960 1:9852204-9852226 TTGGTAGAGCAGTTGGAAGGAGG - Intronic
901668097 1:10837885-10837907 CGGGGGTAGCAGCTGGAAGGAGG + Intergenic
902120449 1:14160443-14160465 GAGGGTGAGGGGCTGGAAGGAGG + Intergenic
902477443 1:16695735-16695757 CAGTATCGGCAGCTGGAAGGCGG + Intergenic
905746982 1:40426492-40426514 CTGGTTGACCAGCTGGAAATTGG + Intergenic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906201737 1:43964815-43964837 GAGGTTGAGCTGCTGCTAGGAGG + Intronic
906318486 1:44802871-44802893 CAGGTTCAGCAGCAGACAGGTGG + Intronic
909086446 1:71174277-71174299 CAGGGTGGGGAGCTGGAAGGAGG + Intergenic
910118635 1:83760274-83760296 CAGGGTGAACAGCTTGCAGGAGG + Intergenic
910149622 1:84126338-84126360 CAGGATGGGGAGCTGGAAAGCGG + Intronic
910581158 1:88826576-88826598 AAGGGTGAGGAGGTGGAAGGGGG - Intronic
910892257 1:92030174-92030196 AAGTTTGAGCAGGTGGATGGAGG - Exonic
911133847 1:94418531-94418553 CAGGCAGAGCAGCAGGAACGCGG - Exonic
912255133 1:108050700-108050722 CAGGTAGAGCAGCAGGATGCAGG - Intergenic
912704685 1:111903294-111903316 AAGGCTGAGCAGGTGGGAGGCGG + Intronic
917099531 1:171431443-171431465 CAGGATGGGCAGCTAGAAAGGGG + Intergenic
917484959 1:175447383-175447405 GAGGGTGGGCAGCGGGAAGGAGG + Intronic
917589194 1:176459633-176459655 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
918081957 1:181214654-181214676 GAGTTTGAGGAGCTGCAAGGTGG - Intergenic
919055501 1:192565062-192565084 CAGGTTGAGAAGCAGCCAGGGGG + Intergenic
921286957 1:213617395-213617417 CTGGTTGTGGAGATGGAAGGAGG + Intergenic
921801326 1:219405936-219405958 TGGGTTGAGCAGCTGAAAGTTGG + Intergenic
923507105 1:234613509-234613531 CAGGTTATGCAGCTGCAAGAGGG + Intergenic
1062802747 10:392223-392245 CAGCTTCTGCAGCAGGAAGGCGG + Intronic
1064002298 10:11673744-11673766 GAGGTGGAGGAGGTGGAAGGAGG + Intergenic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1064681921 10:17818906-17818928 GAGTTTGAGGAGCTGAAAGGTGG + Intronic
1067582150 10:47452648-47452670 CAGGCTGGGAAGCTGGAGGGAGG - Intergenic
1068701501 10:60024710-60024732 CTGGGAGAGCACCTGGAAGGTGG + Intergenic
1069704538 10:70449909-70449931 CAGGTGGAGCATCTAGCAGGTGG + Intergenic
1069800990 10:71081362-71081384 CAGTTAGAGCAGCAGGATGGAGG - Intergenic
1070628704 10:78069173-78069195 CAGGTCGTTCAGGTGGAAGGCGG + Intergenic
1071065194 10:81624272-81624294 AAGGGTGAGGAGGTGGAAGGGGG + Intergenic
1073458412 10:103651572-103651594 AAGGTTGCACAGCTGGGAGGTGG - Intronic
1073938445 10:108663724-108663746 CAGGAAGAGAAGCTGGAAGGTGG + Intergenic
1074895159 10:117770957-117770979 CAGAGGGAGCAGCTGGGAGGTGG + Intergenic
1075234402 10:120713496-120713518 CAGGTTGAGCACCTGAAATTTGG - Intergenic
1075713425 10:124542721-124542743 CGGGGTGAGCCCCTGGAAGGAGG - Intronic
1075851874 10:125595618-125595640 CTGCTTGGGGAGCTGGAAGGGGG - Intronic
1076057735 10:127389376-127389398 AAGGTTGAGAAGCTTGAAGTTGG + Intronic
1076108139 10:127840796-127840818 CAGGATGAGCGGGAGGAAGGTGG + Intergenic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1077214253 11:1388857-1388879 CAGGTTGAGCAGCTGGGCAGGGG - Intergenic
1077281729 11:1749107-1749129 AAGGTTGGGCCGCTGGGAGGCGG - Intronic
1077284525 11:1759779-1759801 CAGGCTGAGCAGGTGGGAGTGGG - Intronic
1079099284 11:17530893-17530915 CAGCGGCAGCAGCTGGAAGGAGG + Intronic
1079413292 11:20209406-20209428 CATTTTGAGCAAATGGAAGGGGG + Intergenic
1079466750 11:20738244-20738266 CAGGTTGAGAGGCTGGCAGGAGG + Intronic
1080396918 11:31898745-31898767 CAGGTGGAGCAGGTGGAAAGGGG - Intronic
1080596760 11:33780026-33780048 CAGTTCTAGCAGCTGGAGGGAGG - Intergenic
1080780052 11:35420707-35420729 CAGGTTACTCAGCTAGAAGGTGG - Intergenic
1081312585 11:41592125-41592147 ATGGATGAGGAGCTGGAAGGGGG + Intergenic
1081620719 11:44617827-44617849 GAGGTTGCTCAGCTGGTAGGCGG + Intronic
1081977224 11:47243254-47243276 CAGCTTGGGGAGCTGGGAGGTGG + Exonic
1082821494 11:57547304-57547326 CAGGCAGAGCCACTGGAAGGTGG + Intronic
1083310556 11:61781531-61781553 CAGGCTAAGAAGCTGGAAGCTGG - Intronic
1083888061 11:65582280-65582302 CCAGGTGAGCAGCTGGCAGGGGG + Exonic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1084576286 11:69989880-69989902 CAGATTGAGTGGCTGGAAGAAGG + Intergenic
1085028807 11:73257512-73257534 TTGGTTGGGCAGCTGGAATGTGG + Intergenic
1085158824 11:74322251-74322273 CAGGTAGAGCTGATGGGAGGAGG + Intergenic
1085450696 11:76630337-76630359 CAGGGGCAGCTGCTGGAAGGAGG - Intergenic
1085454935 11:76660342-76660364 CAGGTTGAGCCGCTGCAGGCTGG + Exonic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1086461289 11:87008330-87008352 CTAGTTGAACAGCTGGATGGTGG - Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1089746538 11:120621440-120621462 CAAGTTGATGAGCTGGGAGGGGG - Intronic
1089928383 11:122283143-122283165 CAGTTCCATCAGCTGGAAGGTGG - Intergenic
1090404585 11:126469151-126469173 GAGGTCACGCAGCTGGAAGGTGG + Intronic
1090660966 11:128881164-128881186 CAGCTTGATCAGCTGGAGGCAGG + Intergenic
1090837862 11:130466459-130466481 CAGGTTGAGCAACCAGAATGTGG - Intronic
1090948384 11:131451487-131451509 CTGGGGGTGCAGCTGGAAGGGGG + Intronic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1091058195 11:132438557-132438579 TAGGGTGGGCAGCAGGAAGGTGG + Intronic
1091058226 11:132438706-132438728 TAGGGTGTGCAGCAGGAAGGTGG + Intronic
1091561172 12:1614759-1614781 GAGGGTAAGCATCTGGAAGGTGG - Intronic
1092469452 12:8764959-8764981 CAGGAGGAGCAGGTGGAATGGGG - Intronic
1093680119 12:21992929-21992951 CATCTTAAGCAGCAGGAAGGAGG + Intergenic
1093769101 12:22998984-22999006 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
1093937759 12:25019406-25019428 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
1096721473 12:53526256-53526278 GAGGTGGAGAAGTTGGAAGGGGG - Intronic
1097803298 12:63938607-63938629 GTGGTTAAACAGCTGGAAGGTGG + Intronic
1098822448 12:75250037-75250059 CAGGTTTTGAAGCTGGGAGGGGG - Intergenic
1099425472 12:82518288-82518310 CAGGATGGGGAGCTGGAAAGTGG + Intergenic
1099799705 12:87442117-87442139 CAGGTAGAGGAGCAGGTAGGTGG - Intergenic
1101854537 12:108431297-108431319 AAGGTTGAACAGCTGGAAACAGG + Intergenic
1101997372 12:109534679-109534701 CAGCTTGAGCAGGTTGAAGCAGG - Exonic
1102073627 12:110042709-110042731 CAGGGTGGGCAGCAAGAAGGGGG + Intronic
1102401975 12:112637825-112637847 CAGGTGGGGCTGCTGGAAAGGGG - Intronic
1102514458 12:113437011-113437033 CACGTCGAGTAGATGGAAGGGGG + Intronic
1102769605 12:115463835-115463857 AAGTTGGAACAGCTGGAAGGAGG + Intergenic
1103809633 12:123603028-123603050 TAGTTTGAGCAGCAGAAAGGAGG + Intronic
1103930647 12:124449126-124449148 GAGGTGTGGCAGCTGGAAGGGGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104224104 12:126814223-126814245 CAGGCTGAGCGGCTGGCAGGTGG - Intergenic
1104276828 12:127336728-127336750 CAGGGAGAGCAACAGGAAGGTGG + Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104675935 12:130712488-130712510 CAGGACGTGCAGGTGGAAGGCGG - Intronic
1104788232 12:131465302-131465324 GAGGTGGAGGAGGTGGAAGGAGG - Intergenic
1104984213 12:132587490-132587512 GAGGGTGGGCAGCTGGAGGGTGG + Intergenic
1105402118 13:20105154-20105176 CACGGTGAGCAGCTGGACTGAGG - Intergenic
1105943249 13:25169993-25170015 CAGCTCGAGCAGCGGGAAGAAGG - Exonic
1106942295 13:34792313-34792335 CAGGATGAGGAGCTGGAAAGGGG - Intergenic
1106962773 13:35019892-35019914 CAGCTGGAGCGGCTGGAGGGAGG - Intronic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108781126 13:53835522-53835544 GAGGTGGAGGAGGTGGAAGGGGG - Intergenic
1112390710 13:98981566-98981588 AAGGTGGGCCAGCTGGAAGGCGG - Intronic
1113375395 13:109760736-109760758 CAAGTTGAGCAGTTTGAAGGTGG - Intronic
1113480789 13:110619068-110619090 CAGGTGGAGCACCTGTCAGGTGG - Intronic
1113709711 13:112455224-112455246 CAGGGAGAGAAGCTGGATGGAGG - Intergenic
1117220015 14:53594215-53594237 CAAGGTGAGCAGCTGGAACCTGG - Intergenic
1117411109 14:55451975-55451997 GGGGTTGAGCAGGTGGAAGATGG - Intronic
1117611381 14:57486348-57486370 AAGGTTGAACAGCTAGAAAGTGG + Intronic
1118305455 14:64651367-64651389 CAGGGTGAATAGCTGGAAAGTGG + Intergenic
1118314350 14:64716640-64716662 CTGGTAGAGCAGTTGAAAGGAGG + Intronic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121396301 14:93626279-93626301 TAGGTGCAGAAGCTGGAAGGTGG - Intronic
1121432157 14:93895209-93895231 GAGGCGGAGCAGCTGGGAGGCGG - Intergenic
1121432161 14:93895225-93895247 GAGGCGGAGCAGCTGGGAGGCGG - Intergenic
1121447455 14:93987988-93988010 GAGGTGGGGCATCTGGAAGGAGG + Intergenic
1121709063 14:96023651-96023673 AAGGTTGAGAAGCTGGGAGATGG + Intergenic
1122518275 14:102324107-102324129 CAGGTTGTGCAGTAGGAAGCTGG + Intronic
1122603164 14:102931053-102931075 GAGGGTGAGGAGCTGGAGGGAGG + Exonic
1122793067 14:104192578-104192600 CAGCTGGAGCAGCTGGGTGGTGG + Intergenic
1202917500 14_GL000194v1_random:190338-190360 CAAGTCAGGCAGCTGGAAGGTGG - Intergenic
1124072018 15:26404122-26404144 CAGGGCCAGCAGCTGGAAAGAGG - Intergenic
1124508644 15:30303583-30303605 CAGCTTGAGCACCTGGGAAGAGG - Intergenic
1124661713 15:31555138-31555160 CAGGATGGACAGCTGGATGGTGG + Intronic
1124734913 15:32235078-32235100 CAGCTTGAGCACCTGGGAAGAGG + Intergenic
1125346523 15:38724038-38724060 CAGGTGGAGCAGCCTGCAGGTGG - Intergenic
1125456517 15:39865548-39865570 AAGGGTGAGGAGGTGGAAGGAGG + Intronic
1125892418 15:43276429-43276451 CAGGGAGGGCAGCTGGAGGGCGG + Exonic
1126894274 15:53241525-53241547 TAGGATGAGCTGGTGGAAGGAGG + Intergenic
1127576674 15:60298529-60298551 ACAGTTGAGCAGCTGGAATGTGG + Intergenic
1128239419 15:66091439-66091461 GAGGTTGAGCATCCAGAAGGAGG + Intronic
1128581778 15:68815760-68815782 GAGGTTGAGCAACTGGTAGGTGG - Intronic
1128674287 15:69597251-69597273 CAGGTTGAGGCGCTGCCAGGTGG + Intergenic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129702562 15:77776131-77776153 CAGGGGGAGGAGCTGGGAGGGGG - Intronic
1131999577 15:98165194-98165216 CACGTTGCGCAGCAGCAAGGTGG - Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1132797457 16:1732221-1732243 GAGCTGGGGCAGCTGGAAGGGGG + Intronic
1132844087 16:1992122-1992144 CACATCGAGCAGCAGGAAGGCGG - Exonic
1134041716 16:11073705-11073727 CACGTGGAGCAGGAGGAAGGAGG - Intronic
1134188261 16:12100851-12100873 CAGGGAGGGCAGCTGGCAGGTGG + Intronic
1134537175 16:15035335-15035357 CAGGCTCAGTGGCTGGAAGGAGG + Intronic
1135389104 16:22074082-22074104 TAGGTGGGGCTGCTGGAAGGAGG - Intronic
1135653801 16:24229953-24229975 AAGGTTGTGCAGCTGGCATGTGG - Intergenic
1135943878 16:26846857-26846879 GAGGTTGCACAGCTGGAAGGAGG + Intergenic
1136186552 16:28591842-28591864 CAAGTTGAGGAGCTGGAGCGGGG + Intergenic
1138171764 16:54857510-54857532 AAGGGTGAGGAGCTGGAAGTGGG + Intergenic
1140461750 16:75145733-75145755 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
1141928323 16:87183833-87183855 CAGGTGGTGCAGCTGGCAGAGGG - Intronic
1142181759 16:88674636-88674658 CAGCTTGAGCACCAGGAAGGAGG - Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1143514542 17:7413279-7413301 CAGGTTGACCTTCTGGCAGGAGG + Intronic
1143554838 17:7653518-7653540 CAGTTAGAGTAGCTGGCAGGGGG - Intronic
1143978020 17:10844599-10844621 GAGGTGGAGCAGTTGGAAGATGG - Intergenic
1144576363 17:16432209-16432231 CATGTTGAGCAGCAGGATGTAGG - Exonic
1144677348 17:17170384-17170406 CAGGTGGAGCCGCTGGGAGAGGG + Intronic
1145264178 17:21371659-21371681 CGGGAGGAGCAGCTGGGAGGAGG - Intergenic
1145975563 17:28981888-28981910 GTGGTTGAGCAGCTTCAAGGTGG + Exonic
1147584649 17:41647353-41647375 CAGGTGGAGATGCTGGGAGGTGG + Intergenic
1147612771 17:41811523-41811545 CGGGTAGGGCACCTGGAAGGCGG + Exonic
1147906311 17:43825428-43825450 AAGGTTGCACAGCTGGAAGGAGG + Intronic
1148104473 17:45112126-45112148 CAGGTTCCGGAGCTGGAGGGAGG + Exonic
1148537769 17:48455166-48455188 CAGGATGGGGAGCTGGAAGGGGG - Intergenic
1149554067 17:57560570-57560592 AAGGTTGCTCAGCTGGTAGGTGG - Intronic
1149702738 17:58668877-58668899 CAGTTTGAGAAGCTGTAGGGTGG + Intronic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1151354199 17:73548833-73548855 CACGGAGGGCAGCTGGAAGGTGG + Intronic
1151620604 17:75242712-75242734 CAGGTAGGGCAGCTGGCAGCAGG + Intronic
1151668614 17:75559296-75559318 CAGGTAGAGCAGCTCGCAGGAGG - Exonic
1152422201 17:80199967-80199989 CAGGGTGAGCCTCTGGAATGAGG - Intronic
1153807391 18:8721330-8721352 CAGGTGCAGCAGATGGGAGGGGG - Intronic
1154082091 18:11267610-11267632 TAGGTTGAGCACCTAGAAGAAGG + Intergenic
1155075237 18:22348696-22348718 CAGGTTGCGGCGCAGGAAGGCGG + Intergenic
1156253276 18:35372604-35372626 CAGGATGATCATCTAGAAGGAGG + Intronic
1156345079 18:36249618-36249640 CCTGTGGAGCAGTTGGAAGGGGG + Intronic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1157394701 18:47331857-47331879 CAGACTCAGAAGCTGGAAGGAGG - Intergenic
1158604012 18:58878783-58878805 CAGGGTTAGCAGCTGTCAGGAGG + Intronic
1158879135 18:61759954-61759976 CAGGTACAGCAGCTGCATGGCGG + Intergenic
1160042797 18:75360821-75360843 CAGGTGGAGGAGCTGAGAGGTGG + Intergenic
1160135010 18:76264468-76264490 CAGCTGGAGCAGCTGAATGGAGG - Intergenic
1160192322 18:76724146-76724168 CCTGTTGAGCAGCAGGAAAGGGG - Intergenic
1160527965 18:79548281-79548303 CAGGGCCAGCAGGTGGAAGGCGG - Intergenic
1161346617 19:3771617-3771639 CAGCTGGTGCAGCTGGTAGGTGG + Exonic
1161725306 19:5925133-5925155 CGGGTAGAGCAGGTGGAAGGTGG - Intronic
1162389109 19:10378415-10378437 CAGGTGGCTCAGCTGGAAAGGGG + Exonic
1162497399 19:11030913-11030935 CAGGTCGAGGAGAAGGAAGGGGG + Intronic
1162583562 19:11545449-11545471 CTGGCTGAGCACCTAGAAGGGGG + Intronic
1163779639 19:19239663-19239685 CAGGATGAGGAGCAGAAAGGAGG - Intronic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1165472219 19:36010238-36010260 CAGATAGAGCATCTGGGAGGAGG + Intronic
1165768021 19:38362717-38362739 CTGGCTATGCAGCTGGAAGGCGG - Exonic
1165949255 19:39464772-39464794 CAGGGTGAGCCGGTGGAAGGAGG - Intronic
1166240908 19:41493046-41493068 GAGGTGGAGCAGCAGGCAGGAGG + Intergenic
1167007190 19:46783821-46783843 CAGTTTGAGCAGGTTGAGGGTGG + Intronic
1168250483 19:55138696-55138718 CAGGCTGAGCATCTGGAGTGAGG - Intronic
1168451836 19:56472514-56472536 GAGGTGGAGGAGCCGGAAGGGGG - Intronic
1202711462 1_KI270714v1_random:21561-21583 CAGTATCGGCAGCTGGAAGGCGG + Intergenic
926206633 2:10838500-10838522 CTGATTGGGCAGCTGGAAGAGGG + Intergenic
926451232 2:13006910-13006932 CAACTTCAGCAGCTAGAAGGAGG - Intergenic
926687659 2:15710442-15710464 GGGGCTGAGCAGCTGGCAGGTGG + Intronic
926764812 2:16314916-16314938 CAGCTGGAGCAGGTGGACGGGGG + Intergenic
927485472 2:23485749-23485771 GAGGTTGCACAGCTGGAAAGGGG - Intronic
927721462 2:25385614-25385636 AAGGTCGTGCAGCTTGAAGGGGG - Intronic
927756784 2:25714827-25714849 CAGCTTGAGAGCCTGGAAGGAGG + Intergenic
928316459 2:30250391-30250413 CAGGTAGAGGAGATGAAAGGTGG - Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928664491 2:33537115-33537137 CAGGATGGGGAGCTGGAAAGGGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931926053 2:67073738-67073760 CATATTGGGCAGGTGGAAGGAGG - Intergenic
932177263 2:69614346-69614368 CAGGTGTAACAGCTGGAAGGAGG + Intronic
933384198 2:81589506-81589528 TCAGTTCAGCAGCTGGAAGGAGG - Intergenic
934712874 2:96527346-96527368 CAGGAAGAGCAGCTGAGAGGAGG - Intergenic
935022497 2:99245201-99245223 CAGGTTGAGCTTCTGTGAGGAGG + Intronic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935222908 2:101029976-101029998 CTGCTTGATCAGCTGGAAAGTGG + Intronic
936152440 2:110029240-110029262 CAGGTTCAGCAGCCTGAACGGGG + Intergenic
936192239 2:110342172-110342194 CAGGTTCAGCAGCCTGAACGGGG - Intergenic
937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG + Intergenic
938112714 2:128579716-128579738 CAGGTTGGGCAGCTGGGCGATGG - Intergenic
938408034 2:131043612-131043634 CAAGTTGAGCAAGTGGAGGGAGG + Intronic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
939700667 2:145386847-145386869 CAGGATGGGGAGCTGGAAAGAGG - Intergenic
940971543 2:159901987-159902009 TAGGTTGAAGAGCTGGAAGGAGG + Intronic
942299180 2:174545983-174546005 CTGGCTGAGCAGGTGGAAGAAGG + Intergenic
943521017 2:188949403-188949425 CGGGATGAGGAGCTGGAAGTGGG - Intergenic
943663804 2:190587767-190587789 CAGGTTGAGTATCAGGAAGTAGG + Intergenic
945318173 2:208392829-208392851 CAGACTGAGCCGCTGGAATGGGG + Intronic
945932294 2:215867052-215867074 CTGGCTTAGAAGCTGGAAGGAGG - Intergenic
946100432 2:217315818-217315840 CAGGATGGGGAGCTGGAAAGGGG - Intronic
947933787 2:233985826-233985848 CAGGTTGACCAGCAGGATGTTGG - Exonic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948846586 2:240685727-240685749 CAGGCCGGGCACCTGGAAGGAGG + Intergenic
948847275 2:240689007-240689029 CAGGCCGGGCACCTGGAAGGAGG - Intergenic
1170645180 20:18191397-18191419 CAGGTTAAGAGGCTGGAAGGTGG + Intergenic
1171012298 20:21515230-21515252 GAGGTGGAGCAGCGGGAAGGCGG + Intergenic
1171173666 20:23035728-23035750 CAGGTTGAGCAGGTAGATGTTGG - Exonic
1171447311 20:25214050-25214072 CAGGATGAGCAGCTGCCATGGGG - Intronic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172240314 20:33408588-33408610 CAGGTCCAGCTGCTGGAGGGTGG + Exonic
1172301746 20:33855312-33855334 CAGGCTGAGCGGGTGGAAGCTGG - Intergenic
1172392677 20:34576523-34576545 CTGGATTTGCAGCTGGAAGGGGG - Intronic
1172576101 20:36009976-36009998 CAGGTTGCGCAGGTAGAAAGTGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173469917 20:43315172-43315194 CAGGTGTTGCAGCTGCAAGGTGG - Intergenic
1173576392 20:44115365-44115387 GAGCCTGAGCAGCTGGAGGGTGG - Intronic
1173906107 20:46630832-46630854 CAGGTTCAACAGCTAGAATGTGG - Intronic
1173985585 20:47259203-47259225 CAGGGTGTGGAGGTGGAAGGAGG + Intronic
1174055791 20:47797295-47797317 CACATAGAGCAGCAGGAAGGGGG - Intergenic
1174418699 20:50385238-50385260 CAGATTGGGCAGCTGCATGGAGG - Intergenic
1174653827 20:52152943-52152965 CAGGCAGAGCAGCCGGCAGGTGG - Exonic
1174760958 20:53207024-53207046 CAGGTTGAGCAGGTGGTAAGGGG - Intronic
1175285070 20:57832357-57832379 CAGGTGGTGAAGCAGGAAGGAGG + Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175731772 20:61359018-61359040 CAGGTTGGGAAGCCGGAATGTGG + Intronic
1176797386 21:13380157-13380179 GATGATGGGCAGCTGGAAGGAGG - Intergenic
1176950412 21:15038847-15038869 GAGGCTGAGCATCTAGAAGGAGG - Intronic
1177826518 21:26090255-26090277 CTGGTTGAGCATCTGGAATCCGG + Intronic
1179513468 21:41890709-41890731 CATGTTGAGGAGGTTGAAGGAGG + Intronic
1179620160 21:42609089-42609111 AAGGTGGAACAACTGGAAGGTGG - Intergenic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179884513 21:44307825-44307847 AAGGTCGAGCAGGTGGCAGGAGG - Intronic
1179904256 21:44414035-44414057 GAGGTTGAGCAGCAGGATGTTGG - Exonic
1180064176 21:45404747-45404769 CCGGTGGGGCAGCGGGAAGGGGG - Intergenic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180625767 22:17192424-17192446 CAGGTGCAGCAGCTGCAAGGCGG + Intronic
1180917229 22:19497697-19497719 CAGGCTGAGCAGCAGGAGTGGGG - Intronic
1184297986 22:43538176-43538198 CAGGCTGAGCAACTGGAAGAAGG - Intronic
1184634726 22:45817976-45817998 CAGGGTGAGAAGCTGGAAGTTGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184767392 22:46578748-46578770 AAGGGTGTGCAGCAGGAAGGAGG - Intronic
949906854 3:8864891-8864913 GAGGGTGAGCAGCTGACAGGAGG + Intronic
950156288 3:10723814-10723836 CAGGTGGTGTACCTGGAAGGTGG + Intergenic
950205488 3:11076978-11077000 CAGTTTTAGCATCTGGAAAGGGG + Intergenic
950641533 3:14351587-14351609 GGGGTTGCGCAGCTGGTAGGTGG - Intergenic
951453417 3:22864606-22864628 TAGGTTGAGCAACTGGAAGAAGG + Intergenic
952382937 3:32818415-32818437 CAGGTTGCTAAGCAGGAAGGCGG - Exonic
952810503 3:37398259-37398281 CAGCCTGAGCACCTAGAAGGAGG - Intronic
953805395 3:46063574-46063596 CAGGTGGAAAAGGTGGAAGGTGG + Intergenic
953827350 3:46265364-46265386 CAGGTTGAGCAGGTAGATGTTGG - Exonic
953972765 3:47359880-47359902 CTGGTGGAGCTGTTGGAAGGAGG + Intergenic
953981646 3:47416241-47416263 CAGGTTCACCAGCTTGGAGGTGG + Intronic
954304650 3:49719196-49719218 CAGGGCGCGCAGCTGGAAGAGGG + Exonic
954411015 3:50371111-50371133 AAGTCTGAGGAGCTGGAAGGAGG + Intronic
954763126 3:52891475-52891497 CAGGTTCATCACCTGGAAGTGGG + Intronic
955037329 3:55281918-55281940 AAGTTTGGGCAGATGGAAGGAGG - Intergenic
957322716 3:78653231-78653253 CATGTTGAGGAACTGGAGGGAGG - Intronic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
959694187 3:109231877-109231899 CAGGATGGGGAGCTGGAAAGTGG - Intergenic
960221418 3:115113859-115113881 CTGGTTGAGCAAATAGAAGGTGG - Intronic
961012820 3:123447733-123447755 CAGGTAGGGCAGCTGGAGCGGGG + Exonic
961372698 3:126441100-126441122 CAGTTTGAGGGGCTGGAATGGGG - Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
963300869 3:143595853-143595875 CAGGTTTGGCAGCAGAAAGGAGG + Intronic
963317157 3:143771917-143771939 CAGGTTGAGCAGGAGGACAGAGG + Intronic
964934043 3:162059729-162059751 CAGGTGGAGCATCTGGGAGCTGG + Intergenic
965236236 3:166127260-166127282 GAGGTTGGGCTGGTGGAAGGTGG - Intergenic
966095524 3:176196552-176196574 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
968442156 4:629507-629529 CAGGGAGAGGAGCTGGAAGGTGG - Intronic
968866726 4:3217672-3217694 CAGCTTGAGCAGCTGGTTGTAGG + Intronic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969344148 4:6560862-6560884 CAGGTTGGGGAGGTGGCAGGAGG - Intronic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
969542417 4:7801255-7801277 CAGTTTGAGGAGCAGGAAGGCGG - Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970142380 4:12996547-12996569 CAGGTACAGAAGCTGAAAGGTGG + Intergenic
970503935 4:16707740-16707762 GAGGCTGAGCAGCTGGATGTTGG - Intronic
971369536 4:26005393-26005415 TAGGGAAAGCAGCTGGAAGGTGG - Intergenic
972667168 4:41177648-41177670 CAGGCTGTGCAGCTAGTAGGTGG - Intronic
976189846 4:82477479-82477501 CAGGAGGAGCAGGTGGAACGTGG + Intergenic
976398440 4:84582724-84582746 GAGGCTGAGGAGCTGGGAGGCGG - Intergenic
977441201 4:97070346-97070368 GTGGATGGGCAGCTGGAAGGGGG - Intergenic
981592248 4:146376606-146376628 CAGGATGGGGAGCTGGAAAGGGG - Intronic
984047051 4:174814303-174814325 CAGGATGCGGAGCTGGAAAGGGG + Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984591434 4:181621854-181621876 AAGCTTAAGCAGCTGGGAGGTGG + Intergenic
984715388 4:182919684-182919706 CAGGCAGAGGAGGTGGAAGGAGG - Intergenic
984752804 4:183295297-183295319 CAAGATGAGCAGCTTGAATGAGG - Intronic
984766132 4:183401917-183401939 CAGGTTATGCACCTGGAAAGTGG + Intergenic
985570636 5:642949-642971 CAGGCACAGCAGCTGGAAGTGGG - Intronic
985661264 5:1157897-1157919 AAGGTTGAGCAGGTGGGAAGAGG - Intergenic
986938901 5:12925543-12925565 AAGGTTGAGCAGCTGAAGAGAGG - Intergenic
987036694 5:14026165-14026187 CAGGTTAAGCAGCTAGAAGGAGG + Intergenic
987332171 5:16866939-16866961 CAGGTCGGGCAGCTGGCAGGAGG - Intronic
988927840 5:36007104-36007126 GAGTTGGAGCAGCTGGAACGTGG + Intergenic
989096655 5:37788200-37788222 CAGGTCGAACAGCTGAAAAGAGG - Intergenic
989719124 5:44504018-44504040 ATGGTTGGGGAGCTGGAAGGGGG - Intergenic
990128406 5:52548326-52548348 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
990618093 5:57528582-57528604 CAGGTTGGGGAGGTGGCAGGAGG - Intergenic
991207451 5:64065896-64065918 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
992857787 5:80880954-80880976 CAGGTTCAGTAGCTTTAAGGCGG - Intergenic
996010347 5:118475469-118475491 CAGGTAGAGCATCTGTAAGGAGG - Intergenic
996536743 5:124585503-124585525 AAGGATGGGGAGCTGGAAGGGGG + Intergenic
998148548 5:139744335-139744357 CAGGTTCAGAAGCAGGAATGGGG + Intergenic
998761266 5:145434676-145434698 CAGGTTGACCAGGTGGCAGTGGG - Intergenic
999721160 5:154400236-154400258 CTGTTTGAGCACCTGGAAGCAGG - Intronic
999918938 5:156296275-156296297 CACCTTGAGGAACTGGAAGGAGG + Intronic
1000407884 5:160907891-160907913 CAGGCTGAGCAGCTAAAAGCTGG + Intergenic
1000852881 5:166362121-166362143 CAGGGTGGGGAGCTGGAAAGGGG + Intergenic
1001043308 5:168352500-168352522 TAGGTCCTGCAGCTGGAAGGTGG - Intronic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002523502 5:179803845-179803867 CGGGTGGAGGAGCTGGCAGGCGG - Intronic
1002860495 6:1075474-1075496 CAGGTGCAGGAGCTGGAAGGGGG - Intergenic
1003638920 6:7860157-7860179 CAGGTTCCCCAGCTGTAAGGTGG + Intronic
1004302175 6:14468737-14468759 CAGCTTGAGGAACTGGGAGGAGG - Intergenic
1004916534 6:20338086-20338108 CAGGTTGGCCACCTGGTAGGGGG - Intergenic
1006381177 6:33698195-33698217 CAGGTTGCACAGCTGGGAAGTGG + Intronic
1006393319 6:33771613-33771635 CAGGCTGAGGAGCTGGCGGGAGG + Exonic
1006609618 6:35286345-35286367 CAGCCTGTGCAGCTGGAAGATGG + Exonic
1006933078 6:37698987-37699009 CGGGTTCGGCAGCCGGAAGGAGG - Intronic
1007128715 6:39449395-39449417 ATAGTTGAGCAGCTGAAAGGCGG - Intronic
1007308465 6:40925728-40925750 CAGGTCGATCAGCTGGGAAGAGG - Intergenic
1008675483 6:53813487-53813509 CAACTTTACCAGCTGGAAGGTGG + Intronic
1010869935 6:81024857-81024879 CAGGAAGAGCAGCTAGGAGGGGG + Intergenic
1013295650 6:108756153-108756175 CAGTTTGAGAAGCTGGTTGGTGG + Intergenic
1013418695 6:109947164-109947186 CAGGTGCTGTAGCTGGAAGGGGG + Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1016488220 6:144566789-144566811 CAGTTTGAGAAGCTGGAATAAGG - Intronic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017795638 6:157841664-157841686 CATGTTGAGGAACTGGGAGGAGG + Intronic
1019400953 7:853541-853563 CGGGTGGACCAGATGGAAGGCGG + Exonic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1020967239 7:14886712-14886734 CAGGTGGGCCAGATGGAAGGTGG - Intronic
1022092646 7:27117657-27117679 CAGCCGGAGCAGCTGGAAGAGGG - Intronic
1022140458 7:27488696-27488718 AAAGAAGAGCAGCTGGAAGGTGG + Intergenic
1022219584 7:28299526-28299548 CATGTTGAGCAACTGAAATGTGG - Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1024216878 7:47255589-47255611 CACATTGAGGAACTGGAAGGAGG - Intergenic
1024676009 7:51638448-51638470 CAGGAGGAGAAGGTGGAAGGAGG + Intergenic
1024996748 7:55278245-55278267 GTGGTTGAGGAGCTGAAAGGAGG + Intergenic
1025152898 7:56574374-56574396 GAGGTTGTGCAGCTGGTGGGAGG - Intergenic
1025252289 7:57359728-57359750 CAGATTGGGCAGCTGCATGGAGG + Intergenic
1025606110 7:63041209-63041231 CAGGTTCTGCAGCAGGGAGGAGG - Intergenic
1025887775 7:65614523-65614545 GAGGAGGAGCAGATGGAAGGAGG - Intergenic
1026568278 7:71508081-71508103 GAGGCTGAGCTGCTGGAATGAGG + Intronic
1026916117 7:74121215-74121237 CAGCTGGAGCAGCTGGACAGAGG + Exonic
1027432831 7:78132277-78132299 CAGGTTAAGCAGTTAGGAGGTGG - Intronic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1031063467 7:117077318-117077340 CAGGTTTTTCAGCTGGAGGGTGG + Intronic
1031854602 7:126907187-126907209 GAGGAGGAGCAGATGGAAGGAGG + Intronic
1032286623 7:130542475-130542497 CAGGTTGAGGACATGGAAGCTGG + Intronic
1032298165 7:130661403-130661425 CAGGTTGAGCTGCTGGAGTAGGG - Intronic
1032803875 7:135337514-135337536 CAGGAACAGCAGCTGGAAGAAGG + Intergenic
1033269591 7:139918708-139918730 CAGCTTCAGCTGCTGGAAAGGGG - Intronic
1033680088 7:143584928-143584950 GAGATAGAGCACCTGGAAGGAGG + Intergenic
1033691747 7:143744514-143744536 GAGATAGAGCACCTGGAAGGAGG - Intergenic
1033945331 7:146709695-146709717 CAAGTAGAGAAGCTGGATGGTGG + Intronic
1034203059 7:149294435-149294457 CAGTTTGGGCTGCTGGAGGGGGG + Intronic
1035824396 8:2629079-2629101 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
1036048221 8:5167295-5167317 CAGGTTGTGCAGCTTCAAAGAGG + Intergenic
1036203438 8:6787927-6787949 CATGCTGAGCTGCTGGGAGGAGG + Intergenic
1036582259 8:10086271-10086293 CAGGTTGAGCAGTTGGATGCTGG + Intronic
1038012577 8:23486737-23486759 CAGGATTAACACCTGGAAGGGGG + Intergenic
1038567124 8:28628995-28629017 CAGAATGAGAAGCTGGAAGGTGG + Intronic
1039479279 8:37859793-37859815 CATCTGCAGCAGCTGGAAGGAGG + Exonic
1039884286 8:41646467-41646489 CAGGCTGAGCACCGAGAAGGCGG + Exonic
1042177159 8:66048133-66048155 GAGGGTGAGCAGCTGGGTGGTGG - Intronic
1043220455 8:77655818-77655840 CAGGTTGGGGAGCTGGAAAGGGG - Intergenic
1044927892 8:97224641-97224663 CAGGTGGAGCAGCTGCAGGGAGG + Intergenic
1044984592 8:97746452-97746474 GAGGCTGTGCAGCTGGAAGGTGG + Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048731181 8:137442353-137442375 CAGCTTGAGCAGCTGTAATAAGG - Intergenic
1049100767 8:140577596-140577618 GAGGAGGAGCAGCTGGAGGGAGG + Intronic
1049529255 8:143146301-143146323 CAGGTTCCGCAGTTGGAAAGGGG - Intergenic
1049790966 8:144472566-144472588 CAGTTTCAGCATCTGGAAGGCGG - Exonic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1052758632 9:32567170-32567192 CAGCTTGAGCAGCTGGCCAGCGG - Exonic
1053260963 9:36663521-36663543 AAGGGTGAGGAGATGGAAGGGGG - Intronic
1053273262 9:36764888-36764910 CAGGTGGCGCAGGTGGCAGGTGG + Intergenic
1053884391 9:42631897-42631919 GAGGTAGAGCAGCTGAAGGGAGG - Intergenic
1053888277 9:42662397-42662419 GAGGTAGAGCAGCTGAAGGGAGG + Intergenic
1054223415 9:62439344-62439366 GAGGTAGAGCAGCTGAAGGGAGG - Intergenic
1054227296 9:62469843-62469865 GAGGTAGAGCAGCTGAAGGGAGG + Intergenic
1056541219 9:87572983-87573005 CAGAATCAGCATCTGGAAGGTGG - Intronic
1057050831 9:91922863-91922885 AAGGCTGAGCAGCTGGACTGGGG - Intronic
1057196154 9:93116453-93116475 CAGGTTCAGAATCTGGGAGGGGG + Intergenic
1057562549 9:96139907-96139929 AAGGGAGAGCAGCTGGAAGAGGG - Intergenic
1058093857 9:100836988-100837010 ATGGATGGGCAGCTGGAAGGGGG - Intergenic
1058170189 9:101670953-101670975 CCGCTTGGGCAGCTGGCAGGGGG - Exonic
1059601136 9:115780607-115780629 CAATTTGAGCAACTGGAAGAAGG + Intergenic
1060661868 9:125409251-125409273 CAAGTCGCGCAGCTGGAAAGGGG + Intergenic
1060748771 9:126155128-126155150 CAGGTTCAGCAGCAGCGAGGAGG + Intergenic
1061622622 9:131821510-131821532 CAGCTTGGGCACCTGGGAGGGGG - Intergenic
1061932779 9:133841873-133841895 CAGGCTGAGCTGGTGGAAAGCGG - Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062546639 9:137066537-137066559 CAGTGTGAGGAGCTGGAAAGGGG - Intronic
1062586653 9:137252675-137252697 CCGGCTGAGCAGCTGGTAGTGGG - Exonic
1203771010 EBV:50198-50220 CATTTTGGGCAGCTGGGAGGCGG + Intergenic
1185605239 X:1365151-1365173 AGGATTGAGTAGCTGGAAGGAGG - Exonic
1185750791 X:2608786-2608808 CCCCGTGAGCAGCTGGAAGGGGG + Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186788024 X:12971485-12971507 CAGGTGGGGCAGATGGTAGGAGG + Intergenic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1192113904 X:68392847-68392869 CCGGATGGGGAGCTGGAAGGGGG - Intronic
1195069148 X:101262731-101262753 ATGGTTGAGCAGGTGGTAGGCGG + Exonic
1197415130 X:126165379-126165401 CAGGGTGGGCAGCTGGTAGATGG + Exonic
1197782765 X:130173398-130173420 CAGTTTGACCAGCAAGAAGGAGG - Intronic
1197827746 X:130608492-130608514 CAGCCTGAGCAATTGGAAGGAGG - Intergenic
1198375045 X:136030526-136030548 CAGGAAGAGCAGCTGGAGTGGGG - Intronic
1200244736 X:154516859-154516881 CAGCTTGAGCAGCTCTGAGGAGG - Intergenic
1201406870 Y:13658594-13658616 TATGGTGAGCAGCTGGAAAGGGG + Intergenic
1201731640 Y:17210854-17210876 CAGGCAAAGGAGCTGGAAGGGGG - Intergenic