ID: 1084043477

View in Genome Browser
Species Human (GRCh38)
Location 11:66555881-66555903
Sequence CAGCCACTGTGGCCCTCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084043477_1084043487 26 Left 1084043477 11:66555881-66555903 CCTCACGAGGGCCACAGTGGCTG 0: 1
1: 0
2: 0
3: 19
4: 231
Right 1084043487 11:66555930-66555952 CTCACACTTTGCTCACCCCAAGG 0: 1
1: 0
2: 3
3: 12
4: 155
1084043477_1084043488 29 Left 1084043477 11:66555881-66555903 CCTCACGAGGGCCACAGTGGCTG 0: 1
1: 0
2: 0
3: 19
4: 231
Right 1084043488 11:66555933-66555955 ACACTTTGCTCACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 123
1084043477_1084043489 30 Left 1084043477 11:66555881-66555903 CCTCACGAGGGCCACAGTGGCTG 0: 1
1: 0
2: 0
3: 19
4: 231
Right 1084043489 11:66555934-66555956 CACTTTGCTCACCCCAAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084043477 Original CRISPR CAGCCACTGTGGCCCTCGTG AGG (reversed) Intronic
900105553 1:979419-979441 CAGCAACTGGGGCCCACGGGGGG - Exonic
901847238 1:11991240-11991262 CAGATAGTGTGGCCCTCATGAGG + Intronic
902818723 1:18930602-18930624 CTGCCACAGTGGCCCTTGTTAGG - Intronic
903669046 1:25024808-25024830 CAGCCACTGTAGCCCTTATGTGG - Intergenic
904309502 1:29619182-29619204 CAGACACTGTGGCCTACCTGAGG + Intergenic
904916018 1:33971248-33971270 CAGCTAATGTGGCCCAGGTGGGG - Intronic
904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG + Intergenic
906523335 1:46479817-46479839 CAGCCCCTGTGGCCGTGCTGGGG + Intergenic
907577056 1:55536080-55536102 CAGACACTGGGGCCCACCTGAGG + Intergenic
907886255 1:58594724-58594746 CAGCCACAGTGGCCTCTGTGGGG - Intergenic
908998785 1:70192792-70192814 CAGACACTGGGGTCCTCTTGAGG + Intronic
910778338 1:90899078-90899100 CAGCCACGGTGGCCTTCTTCCGG + Intergenic
912337110 1:108873616-108873638 CAGCCACAGTGGCCTTCCTCCGG + Intronic
912420904 1:109541745-109541767 AGGCCACTGTGCCCCTCTTGTGG - Intronic
912478307 1:109957208-109957230 AAGCCACTGAGGCCCTGGAGAGG + Intergenic
912611222 1:111046688-111046710 CAGACACTGTGGCCTACCTGAGG - Intergenic
914693744 1:150055864-150055886 CAGACACTGGGGCCCACTTGAGG + Intergenic
915514058 1:156402422-156402444 GACCCACTGTGGCCCTGGGGAGG - Intergenic
917228340 1:172808179-172808201 CAGCCACTGGGGCCTACTTGAGG - Intergenic
918803987 1:189015614-189015636 CAGGCACTGGGGCCCACTTGAGG - Intergenic
921480490 1:215659326-215659348 CAGCCACACTGGCCTTCTTGAGG - Intronic
921793289 1:219313988-219314010 CAGACACTGGGGCCCACTTGAGG - Intergenic
922351105 1:224735150-224735172 CAGCCACTGTGGGGCTGGGGTGG - Intronic
923543474 1:234906861-234906883 CAGTCACTGAGGCACTCGGGGGG + Intergenic
1062854961 10:775476-775498 CAGCCCCTGTGTCCAGCGTGAGG + Intergenic
1063456312 10:6185141-6185163 AGGCCACAGAGGCCCTCGTGGGG - Intronic
1065809883 10:29431519-29431541 CAGCCACTGTGCCCGGCCTGAGG + Intergenic
1067066611 10:43107360-43107382 CTGCCACTGTGGATCTCATGTGG - Intronic
1067788225 10:49268135-49268157 CAGCCATTGTGGTCTTGGTGGGG + Intergenic
1076752671 10:132551469-132551491 CAGCCACTGTGGGTCATGTGGGG + Intronic
1076882213 10:133245108-133245130 CAGCCACTGAGACCCTGCTGAGG - Intergenic
1077044874 11:540336-540358 CAGCCCCTGTGGGCCTCAGGTGG + Intronic
1077412561 11:2410473-2410495 CCGCCCCTGGGGCCCTCGAGGGG - Intronic
1083377710 11:62239397-62239419 CAGCCACTGTTGCCCTCAGCTGG + Intergenic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084701350 11:70788186-70788208 CATCCACAATGGCCCTGGTGGGG - Intronic
1087749646 11:101993220-101993242 CAGACACTGGGGCCCACTTGAGG - Intronic
1089751194 11:120652458-120652480 CAGCCTCTGTGGCCTCCTTGAGG - Intronic
1090133210 11:124167795-124167817 CAGACACTGGGGCCCTTTTGAGG + Intergenic
1091992201 12:4964411-4964433 CAGCCATTGTGCCCTTCTTGGGG + Intergenic
1092632856 12:10402591-10402613 CAGACACTGTGGCCTACCTGAGG + Intronic
1094843582 12:34351927-34351949 CAGCCTCTTTGCCCCCCGTGGGG + Intergenic
1094856354 12:34404633-34404655 AAGGCACTTTGGCCCTTGTGGGG - Intergenic
1095699156 12:45173493-45173515 CAGCGACTGAAGCCCTCTTGTGG - Intergenic
1095728733 12:45481080-45481102 CAGACACTGGGGCCCACTTGAGG - Intergenic
1096257759 12:50073416-50073438 CTGCCACAGAGGCCCTGGTGAGG + Intronic
1096529889 12:52235916-52235938 CAGCCTCTGCGGCCCTCGCATGG - Intronic
1096557744 12:52413868-52413890 CTGACACTGTGGCGCTCATGGGG + Intergenic
1100563324 12:95770598-95770620 CAGCCAATCTGGCCCTTCTGAGG - Intronic
1100754300 12:97733343-97733365 CAGTCCCTGTGGCCCTCCTCCGG + Intergenic
1101957343 12:109222948-109222970 CACACACTGTGGCCCAGGTGGGG + Intronic
1102789719 12:115634823-115634845 TAGCCACTGTGGCCTCCATGAGG + Intergenic
1103705005 12:122866684-122866706 CGGCCACTGCAGCCCTGGTGAGG - Exonic
1104536248 12:129620802-129620824 CACACACTGGGGCCCTCTTGGGG + Intronic
1104802936 12:131566968-131566990 CTGCCCCTGTGGCCCCCGTGAGG + Intergenic
1104861996 12:131928893-131928915 CACCCTGTGCGGCCCTCGTGTGG - Intergenic
1104924229 12:132305777-132305799 AAGCCAGTGAGGCCCTCGGGTGG + Intronic
1105288892 13:19033303-19033325 CAGCCAGTGTGGCCCTCCCCAGG + Intergenic
1108046276 13:46387314-46387336 GAGCTACGGTGGCCCCCGTGTGG - Exonic
1108160309 13:47632222-47632244 CAGCCCCTGTGGCTCTCAGGTGG - Intergenic
1113742466 13:112721061-112721083 CAGCAACTGTGGCCCTCAGCTGG - Intronic
1114279335 14:21176798-21176820 CAGACACTGTGGCCTACCTGAGG + Intergenic
1114531484 14:23399275-23399297 GAGGCACTGTGGGCCTTGTGGGG - Intronic
1117272047 14:54154646-54154668 CAGACACTGGGGCCCACTTGAGG - Intergenic
1118704835 14:68471218-68471240 CAGCCACTGTGGCCGACATTCGG + Intronic
1119205046 14:72787962-72787984 CAGCACCTGTGGGCCTCCTGGGG - Intronic
1119483322 14:74973398-74973420 CAGCCACCGTGGCCAGCGGGAGG - Intergenic
1121557148 14:94847012-94847034 CAGCCCCGGTGGCCCCTGTGCGG - Intergenic
1122236242 14:100332165-100332187 CAGCCAGTGTGACCCTGGGGAGG + Intergenic
1122717094 14:103702339-103702361 GAGCCCCTGTGCCCCTAGTGAGG + Intronic
1122986862 14:105216491-105216513 CAGCCCATGCGGCCCTCCTGAGG + Intronic
1123676512 15:22714870-22714892 CAGCCGCTGTGGCGCCCGGGCGG - Intergenic
1126712845 15:51480607-51480629 CAGCTACTGTAGCCTTCATGGGG - Exonic
1127011073 15:54629266-54629288 CAGACACTGTGGCCTACTTGAGG + Exonic
1129893058 15:79084603-79084625 CACCCACTGTCCTCCTCGTGGGG + Intronic
1131184012 15:90259984-90260006 CAGGCCCTGTGGCTCTCGTGGGG - Intronic
1131352770 15:91716981-91717003 CACCCGCTCTGTCCCTCGTGGGG + Intergenic
1131475039 15:92731084-92731106 CAGCCACTGTGGAAATCGTTTGG + Intronic
1131957136 15:97748612-97748634 CAGCCACTGTGGGCCCCCAGTGG + Intergenic
1132226774 15:100148920-100148942 AAGCAACTGTGTCCCTGGTGGGG + Intronic
1132857828 16:2054931-2054953 CAGCCACTGAGGCCCTTTTCTGG - Intronic
1134768195 16:16780931-16780953 CAGGCACACTGGCCCTCCTGAGG - Intergenic
1137511892 16:49107900-49107922 CATCCTCTGTGGCCCTGGAGTGG - Intergenic
1137714633 16:50591275-50591297 TAGCCACTGTGGCTCCCCTGTGG + Intronic
1138631542 16:58298449-58298471 CAGACACTGGGGCCTTCTTGAGG - Intronic
1138979265 16:62246776-62246798 CATCCACTGTGACCCTCCAGGGG - Intergenic
1141040872 16:80671276-80671298 CAGCCACTCTGGCCTTCCTCTGG - Intronic
1141565522 16:84899172-84899194 GAGCCACTGTGCCCCGCCTGAGG + Intronic
1142178928 16:88657823-88657845 CTGCCTCTGTGCCCCTCCTGAGG - Intronic
1143012146 17:3872004-3872026 CTGCCACGGTGGCCGTCATGAGG + Intronic
1144507864 17:15848574-15848596 CAGCCTCTGTGTGCCACGTGGGG + Intergenic
1144890259 17:18490307-18490329 CAGCTCCTGTGTCCCTGGTGAGG - Intronic
1145141957 17:20454011-20454033 CAGCTCCTGTGTCCCTGGTGAGG + Intronic
1145265850 17:21379325-21379347 CAACCTCTGTGGCCCTCGCCAGG + Intronic
1145793945 17:27644888-27644910 CAGCTCCTGTGTCCCTAGTGAGG - Intronic
1145808745 17:27752423-27752445 CAGCTCCTGTGTCCCTGGTGAGG - Intergenic
1146893442 17:36524021-36524043 CAGCCACTGTAGCCCTGGGCTGG - Intronic
1147609193 17:41791794-41791816 CCTCCACTCTGGCCCTCCTGGGG + Intergenic
1147675914 17:42205477-42205499 CAGCCTCCCTGGCCCTCCTGAGG + Intronic
1148076816 17:44941888-44941910 CAGCCACACTGGCCCTCAGGAGG - Intronic
1148732474 17:49845877-49845899 CAGCCACTGACGTCCTGGTGGGG - Intronic
1152527961 17:80900287-80900309 CTTCCACTGTGGCCCTCCTGGGG + Intronic
1152644339 17:81461836-81461858 CAGCCACCGTGGCCCTGGACAGG - Exonic
1152700318 17:81815308-81815330 CAGGCACTGGGGCCCTCCTGGGG + Intergenic
1152736788 17:82001090-82001112 CAGCCGGTGTGGGACTCGTGGGG + Intronic
1154120960 18:11652173-11652195 CAGCCACTGTGGTGCTGGTGGGG + Intergenic
1158695090 18:59696948-59696970 CAGCCAGTGTGGCACCCGGGGGG + Intronic
1159057850 18:63484157-63484179 CAGCCACAGTGGCCATTGTCGGG - Intronic
1160685650 19:435319-435341 CAGCGACTGTGGGCCAGGTGGGG - Intronic
1160804120 19:984275-984297 CCGCCGCTCTGGCCCGCGTGGGG + Exonic
1161093355 19:2374752-2374774 GAGCCTCTGTGGCCTTGGTGAGG + Intergenic
1161586737 19:5109765-5109787 GGGCCACCGTCGCCCTCGTGAGG + Intronic
1165775338 19:38401115-38401137 GAGCCACTGTGGCCCACCTCTGG + Intergenic
1165900348 19:39166769-39166791 CGGCCTCTGTGGCCCCCATGAGG + Intronic
1166062640 19:40336250-40336272 CACCCACTCTGGCCCACCTGGGG - Intronic
1166100639 19:40569651-40569673 CAGCCAGGGTGGCCTTCCTGGGG - Exonic
1168135187 19:54346251-54346273 CAGTAACTGTGGCCATTGTGTGG - Intergenic
1168352861 19:55686499-55686521 AAGGGCCTGTGGCCCTCGTGGGG + Intronic
925493165 2:4418409-4418431 CAGACACTGGGGCCCACTTGAGG + Intergenic
926074824 2:9933558-9933580 CACCACCTGTGGCCCTTGTGTGG + Intronic
926697975 2:15784048-15784070 CAGCCAATGTAGCCCTGTTGTGG + Intergenic
927931739 2:27049993-27050015 CAGCCTCCGAGGCCCACGTGAGG - Intronic
929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG + Intergenic
930365610 2:50435783-50435805 CAGACACTGGGGCCTTCTTGAGG + Intronic
931913969 2:66932908-66932930 CAGCCACAATGGCCCTCCTTTGG - Intergenic
932236736 2:70126410-70126432 GAGCCACTGTGCCCCGCCTGTGG + Intergenic
932296549 2:70628409-70628431 CAGACACTGTGGCCTCCTTGAGG - Intronic
932420244 2:71597200-71597222 AGGCCACTGAGGCCCTCTTGAGG + Intronic
932493942 2:72137518-72137540 TGGCCACTATGGCCCACGTGGGG - Intronic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
933498233 2:83078357-83078379 CAGACACTGGGGCCCACTTGAGG - Intergenic
935814845 2:106837988-106838010 CAGCCACTGTGAGCAGCGTGGGG + Intronic
937067601 2:119029742-119029764 CAGTCTCTGTGGCCATTGTGTGG + Intergenic
937806669 2:126152733-126152755 CAGACACTGTGGCCTACTTGAGG - Intergenic
940817037 2:158308741-158308763 CATGCACTGTGACCCTCCTGTGG + Intronic
941784171 2:169479774-169479796 GGGCCACTGTGGCCCTCTCGAGG + Intronic
942449849 2:176101960-176101982 CAGCTACTGTGCCCCTTCTGAGG + Intergenic
943165928 2:184325948-184325970 CAGCCACTGTGGAAATCGTTAGG + Intergenic
944336055 2:198536624-198536646 CAGACACTGGGGCCCACTTGAGG + Intronic
944500579 2:200355167-200355189 GAGCCACTGTGGCACTGCTGTGG + Intronic
945604121 2:211906714-211906736 CAGACACTGTGGCCTACTTGAGG - Intronic
946727453 2:222674612-222674634 CAGACACTGTGGCCTACATGAGG - Intronic
947217354 2:227761362-227761384 CAGATACTGAGGCCCTGGTGTGG + Intergenic
947728705 2:232416602-232416624 CAGCTACTGGGGCCGTGGTGAGG - Intergenic
948852240 2:240714161-240714183 CAGCACCTGGGGCCCTGGTGGGG - Exonic
1171045967 20:21809573-21809595 CAGCCTCTGTGGCCCTTTTCTGG - Intergenic
1172092155 20:32440880-32440902 CAGGCTGTGTTGCCCTCGTGTGG + Intergenic
1172271477 20:33657903-33657925 CACTCACTGTGGCCCTGGAGGGG - Intronic
1172293782 20:33793627-33793649 CTGGCACAGTGTCCCTCGTGTGG - Intergenic
1172611598 20:36256495-36256517 CAGTCACGGTGGCTCTGGTGAGG - Exonic
1173656007 20:44700783-44700805 CAGCCACTGTGGCCACAATGGGG + Intergenic
1173927228 20:46789829-46789851 CAGCCACTGCTGCCCTCCTCCGG + Intergenic
1174622469 20:51886387-51886409 CAGGCATTGTGGACCTCGTGAGG + Intergenic
1174827052 20:53777946-53777968 CAGAGACTGTGACCCTCTTGTGG + Intergenic
1177493354 21:21856899-21856921 CAGCCACTGAGGCCAACTTGAGG + Intergenic
1178850854 21:36210937-36210959 CAGGCCCTGTGGCAGTCGTGTGG - Intronic
1179154114 21:38835014-38835036 CAGCCACTCTGGGGCTGGTGGGG + Intergenic
1181082122 22:20422966-20422988 CAGCCACTGGAACCCTCCTGGGG + Intergenic
1181305607 22:21915804-21915826 CAGTCACTGTGGCCATAGTCAGG - Intergenic
1181800823 22:25346876-25346898 CCGCCCGTGTGGCCCTGGTGTGG - Intergenic
1182098751 22:27643178-27643200 CAGCCACTGTGTCCCACCTCTGG - Intergenic
1183065993 22:35363177-35363199 CAGGCACTGTGGCACACCTGTGG - Intergenic
950534455 3:13571105-13571127 CAGCCGCTGTGGGCCTGGGGAGG - Exonic
953225857 3:41019867-41019889 CAGACACTGGGGCCCACTTGAGG + Intergenic
953589984 3:44242077-44242099 CAGGCCCTGAGGCCGTCGTGGGG - Exonic
953982272 3:47418748-47418770 CAGGCACTGCGGCCGTCCTGAGG + Exonic
954936397 3:54330852-54330874 CAGTCACTGTGGCCATGGTCTGG + Intronic
959922721 3:111886368-111886390 AAGCCATTGTGGGCCTTGTGCGG - Intronic
960475176 3:118116006-118116028 CAGACACTGGGGCCCACTTGAGG + Intergenic
961571023 3:127798847-127798869 CAGTCACTGGGGCCCTGGTCAGG + Intronic
961867778 3:129966540-129966562 CAGCCCCTGTGCCCCTTATGAGG - Intergenic
962383694 3:134916304-134916326 CTCCACCTGTGGCCCTCGTGTGG - Intronic
963003008 3:140700764-140700786 CAGCCACTGTGGTGGTCGTGAGG + Intronic
964626948 3:158768745-158768767 GAGCTACTGTGGGCCTGGTGTGG - Intronic
966880230 3:184345837-184345859 CCACCCCTGTGGCCCTCTTGTGG - Intronic
967010689 3:185430461-185430483 CAGACACTGGGGCCTACGTGAGG - Intronic
968592985 4:1468863-1468885 CAGCCACTGGGGGCCTCCTCTGG - Intergenic
968739330 4:2319448-2319470 CAGCACCTCTGGCCCTCATGGGG + Intronic
969327805 4:6453816-6453838 CAGCCAACGTGGCCCTCGGTGGG - Intronic
972615710 4:40696003-40696025 CAGCCACAGTGGTCCTCTTTTGG + Intergenic
972745083 4:41924562-41924584 AAGCCACTGTGGCTCTGCTGGGG + Intergenic
976470731 4:85425603-85425625 CAGACACTGGGGCCCACTTGAGG - Intergenic
981082263 4:140647289-140647311 CAGCCACTGTGGAACTCTGGGGG - Intronic
982483141 4:155935377-155935399 AAGCCACTGTGGCTGTAGTGTGG - Intronic
985145704 4:186892312-186892334 CAGACACTGTGGTTCTCCTGCGG + Intergenic
985838949 5:2291321-2291343 CAGCCCCTCTCACCCTCGTGAGG - Intergenic
986279866 5:6314246-6314268 CAGCCCCTGTGTCTTTCGTGGGG + Intergenic
990295051 5:54392999-54393021 CAAACACTGTGGCCTTCTTGAGG - Intergenic
991777355 5:70098070-70098092 CAGGCACTGTGGCTCACTTGAGG + Intergenic
991856643 5:70973514-70973536 CAGGCACTGTGGCTCACTTGAGG + Intronic
992609266 5:78493221-78493243 TTCCCACTGTGGACCTCGTGAGG - Intronic
993350102 5:86839110-86839132 CAGTCACTGTGGACCACGAGAGG - Intergenic
993506709 5:88717352-88717374 GAGCCACTTTGGCCATCCTGGGG - Intergenic
994576304 5:101583787-101583809 CAGACACTGGGGCCTACGTGAGG - Intergenic
997653194 5:135536990-135537012 CAGCCTCTGTGGCCCTCTTCAGG + Intergenic
1000995056 5:167950308-167950330 CAGCTTGTGTGGCCCTTGTGAGG - Intronic
1004465437 6:15880832-15880854 CAGACACTGAGGCCCCCTTGAGG - Intergenic
1004516715 6:16327398-16327420 CAGCCACTTTGTCCCTCGGGAGG - Exonic
1005438203 6:25837391-25837413 CAGCCATTGTGGCCCTGATGGGG + Intronic
1007104017 6:39270991-39271013 CAGCCCCTGCAGCCCTCGTGGGG - Intergenic
1007753491 6:44083984-44084006 CAGCCACTGCTGCCCTGCTGGGG + Intergenic
1008600455 6:53089037-53089059 CAGCCTCTGTAGCCCTAGTGGGG + Intronic
1012179015 6:96127197-96127219 CAGCCACTGGGGCCTACTTGAGG - Intronic
1012422215 6:99077981-99078003 CAGCTACTGTGGACCTCCTAAGG + Intergenic
1014335385 6:120127229-120127251 CAGACACTGGGGCCTTCTTGAGG - Intergenic
1015474031 6:133638838-133638860 CAGCCACTGGGGCCTACTTGAGG - Intergenic
1016578340 6:145597734-145597756 CAGACACTGGGGCCTTCTTGAGG - Intronic
1017266154 6:152449038-152449060 GAGGCTCTGTGGCCCTGGTGGGG + Intronic
1017277320 6:152584514-152584536 CAGCTACTGTGGTCCCAGTGAGG - Intronic
1019175382 6:170156857-170156879 CTGCCTCTGTGGCCCATGTGTGG - Intergenic
1019570846 7:1711352-1711374 CTGCCACTGAGGCCCGCCTGTGG + Intronic
1019713455 7:2527791-2527813 CAGCCACTGGGGGCTTCGTGGGG - Exonic
1020817003 7:12917837-12917859 CAGACACTGTGGCCTACTTGAGG - Intergenic
1021144271 7:17065998-17066020 CAGCCGCTGTGGCTCCCGTTAGG + Intergenic
1021523181 7:21556685-21556707 CAGACACTGTGGCCTTCTTGAGG - Intronic
1022403266 7:30061997-30062019 CAGCGACTGAAGCCCTCTTGTGG + Exonic
1026602916 7:71791531-71791553 CAGACACTGGGGCCCACTTGAGG + Intronic
1028323639 7:89494917-89494939 CAGACACTGTGGCCTACTTGAGG + Intergenic
1031010675 7:116523444-116523466 CAGGCACTGGGGCCCACTTGAGG - Intergenic
1033152127 7:138924686-138924708 CAGCCGCTTTGTCCCTCCTGGGG - Intronic
1034162761 7:149005086-149005108 CAGCTGCTGTGCTCCTCGTGCGG - Intronic
1035105838 7:156440967-156440989 CAGACACTCTGGCTGTCGTGTGG - Intergenic
1035278592 7:157763384-157763406 CAGTCACTGTGGCCATGGGGCGG + Intronic
1037300948 8:17451376-17451398 CAGCCCCTGGGGCCTTCTTGAGG - Intergenic
1037524869 8:19714929-19714951 CAGACACTGGGGCCCACTTGAGG - Intronic
1040888570 8:52291294-52291316 CAGCCACTGTAGGCATCGTGTGG - Intronic
1040935652 8:52779070-52779092 CAGACACTGGGGCCTTCTTGAGG - Intergenic
1040986437 8:53298840-53298862 CAGACACTGGGGCCCACTTGAGG - Intergenic
1041278600 8:56189359-56189381 CAGTCACTGTTGCCATCTTGTGG + Intronic
1042727144 8:71890396-71890418 GAGCCACTGGGCCCCTCCTGAGG + Intronic
1045192091 8:99893313-99893335 CAGCCATTGTGACCTTGGTGAGG - Intronic
1047099261 8:121658073-121658095 CAGACACTGGGGCCCACCTGAGG - Intergenic
1049629827 8:143647666-143647688 CAGGCCCAGTGGCCCTTGTGGGG + Intronic
1049912689 9:284922-284944 CAGACACTGTGGCCTACTTGTGG + Intronic
1050325242 9:4491390-4491412 GTGCCACTGTGGCCCGCGGGAGG + Intronic
1056023535 9:82466717-82466739 CAGCCACTGTGGTTCCCCTGGGG + Intergenic
1056116631 9:83447389-83447411 CATCCAGTGTGGCCCTGTTGGGG + Intronic
1057380675 9:94564641-94564663 CAGACACTGGGGCCTACGTGAGG + Intronic
1060037061 9:120264617-120264639 CATCCACTGTGGCCATGGTAGGG - Intergenic
1060243714 9:121926471-121926493 CAGCCACTGTGCCCATCATCGGG - Intronic
1060337082 9:122735292-122735314 CAGACACTGTGGCCTACCTGAGG + Intergenic
1060510048 9:124225069-124225091 CAGTCACAGTGGCCCTTGTGAGG + Intergenic
1062082033 9:134629394-134629416 CCGCCTCTGTGCCCCTCGGGTGG + Intergenic
1062195076 9:135268585-135268607 GAGCCACTGTGGCCCACATGTGG + Intergenic
1062294800 9:135818745-135818767 CAGCCTCTGTGTCCCGCTTGTGG - Intronic
1062454940 9:136631639-136631661 CATCCATGGTGGCCCTCCTGGGG - Intergenic
1185772406 X:2774474-2774496 CAGCTACTTTGGCCATCCTGTGG + Intronic
1185867735 X:3638451-3638473 CAGGCAATGCTGCCCTCGTGTGG + Intronic
1193428762 X:81373957-81373979 CAGACACTGGGGCCCACTTGAGG - Intergenic
1198011447 X:132559796-132559818 CAGACACTGTGGCCTACTTGAGG - Intergenic
1199063009 X:143381207-143381229 CAGACACTGGGGCCTACGTGAGG - Intergenic