ID: 1084044938

View in Genome Browser
Species Human (GRCh38)
Location 11:66563045-66563067
Sequence CTCGCGCCGCAGCTCCTCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044938_1084044947 17 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044938_1084044942 -7 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044938_1084044949 29 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044938_1084044950 30 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044938 Original CRISPR CTCGCGCCGCAGCTCCTCGG GGG (reversed) Exonic
900113529 1:1019557-1019579 TCCGCGCCGCAGCTCCCGGGGGG + Intergenic
900159858 1:1218401-1218423 CTCCCGCCACAGCACCTCGCAGG + Intronic
900185681 1:1332118-1332140 CTCCTGCAGCAGCTCCGCGGCGG - Exonic
900400443 1:2470846-2470868 CTCCCTCTGCAGCTCCTCTGGGG + Intronic
902447827 1:16478329-16478351 CTGGCGCCGCAGCTCCTCCTGGG + Intergenic
902467727 1:16628542-16628564 CTGGCGCTGCAGCTCCTCCTGGG + Intergenic
902506854 1:16944186-16944208 CTGGCGCCGCAGCTCCTCCTGGG - Exonic
903467207 1:23559842-23559864 TTCGAGCCACAGCTCCTCCGAGG + Intergenic
904237341 1:29123856-29123878 CTGGCGCCGCAGCGCCGCGCGGG + Intronic
904642060 1:31938375-31938397 CTCCCGCCGCCGCCCCTCAGGGG + Exonic
910756823 1:90702864-90702886 CTAGAGCCCCAGCTACTCGGGGG + Intergenic
912386417 1:109273244-109273266 CTCCCGCAGCCGCTCCTCAGGGG - Exonic
914342781 1:146774462-146774484 CTGGAGCCGAAGCTCCTGGGAGG - Intergenic
916052388 1:161045545-161045567 CCCGCGCCCCAGCTGCTCCGCGG + Intronic
920260321 1:204684525-204684547 CTCACCCCGCGGCTCCTCGCCGG + Intronic
1063407719 10:5813122-5813144 CGCGGGTCGCAGCTCCTCGGGGG - Intronic
1064028916 10:11870331-11870353 CGCGGGCCGCGGCTCCTCGGAGG + Exonic
1072188504 10:93063022-93063044 CCCGCGCCGCGGAGCCTCGGAGG - Intronic
1075047523 10:119158157-119158179 CTCCTGCCCCAGCTCCTTGGGGG - Intronic
1076687680 10:132205373-132205395 CTCCCGCAGCCGCTCCTCAGAGG + Exonic
1077505737 11:2929335-2929357 CTCGCGTAGCACCTCGTCGGGGG + Exonic
1084044938 11:66563045-66563067 CTCGCGCCGCAGCTCCTCGGGGG - Exonic
1086590462 11:88509068-88509090 GGCGCGCAGCAGCTCCTCGCAGG - Exonic
1101750422 12:107578947-107578969 CTCCCGCCGCAGCTCCAGGATGG - Intronic
1102997554 12:117361548-117361570 TTAGCGCCGCGGCTCCTCCGAGG - Exonic
1103505929 12:121442408-121442430 CTGGTGCCGCAGCTCCCGGGGGG + Exonic
1103721684 12:122978745-122978767 CTCGTGCAGCAGCACCTGGGAGG - Exonic
1115306956 14:31943617-31943639 CTCACTCCTCAGCTCCCCGGAGG - Intergenic
1118760008 14:68874985-68875007 CTCGCGGCGCAGCTCGTCCATGG + Exonic
1119487716 14:75002739-75002761 CGCGCGCCCCCGCGCCTCGGGGG - Intergenic
1121828936 14:97033435-97033457 CTCCCGCCCCAGCTCCTGGCCGG + Intergenic
1128605194 15:69031749-69031771 CTCGTCCCGGAGCTCCTCGAAGG - Exonic
1129165274 15:73773717-73773739 CTTGCTCTGCTGCTCCTCGGGGG + Intergenic
1129423841 15:75451174-75451196 CTCGCGCCGCCGCTCAGAGGCGG - Intronic
1131517319 15:93088281-93088303 CTCGCGCCGCAGCTCAACCCAGG - Intronic
1132754176 16:1474681-1474703 CGCGCCCCGGGGCTCCTCGGCGG - Intronic
1132804957 16:1771148-1771170 CTCACGCAGCAGCTCCTCGGAGG + Exonic
1132884978 16:2178636-2178658 CGCGCCCCGCAGCGACTCGGCGG - Exonic
1133784582 16:8964083-8964105 CCTGCGCCGCAGCCCCGCGGCGG + Intronic
1137238194 16:46632998-46633020 CCCTCTCCGCAGCTCCTCGGCGG + Intergenic
1137735277 16:50719161-50719183 CTCCAGCCTCAGCTCCTTGGAGG - Intronic
1139991204 16:70940866-70940888 CTGGAGCCGAAGCTCCTGGGAGG + Intronic
1142855140 17:2724909-2724931 CTCCCGCCGCAGCTCCGCGTTGG + Intergenic
1144855319 17:18264250-18264272 CTCGAGCAGCAGCTCCTCCGAGG - Exonic
1146034038 17:29390646-29390668 CCCCCGCCGCGGCCCCTCGGCGG - Exonic
1146054045 17:29572500-29572522 CTCGCGCAGCAGCGCCTCCACGG + Exonic
1152042130 17:77910155-77910177 CTCACGCTGCATCTCCTGGGTGG + Intergenic
1152196466 17:78921298-78921320 CTGGAGCTGGAGCTCCTCGGGGG + Intronic
1152630013 17:81406698-81406720 CTCCCGCGGCAGCTGCTCTGGGG - Intronic
1152781438 17:82228891-82228913 CCCGGGCCGCAGCTCCCCGACGG - Intronic
1161175951 19:2842070-2842092 CCCGCGGCTCAGCTCCTTGGAGG + Intronic
1161379913 19:3959443-3959465 CTCGCGCAGGCCCTCCTCGGCGG + Exonic
1161769283 19:6222568-6222590 CTCACGCTCCAGCTCCTTGGAGG + Exonic
1161979768 19:7624308-7624330 CTCGCGCCCCAGCTCCGAGGCGG + Exonic
1162391629 19:10393510-10393532 CTCCAGCCACAGCTCCTCAGAGG + Intronic
1165784436 19:38452935-38452957 CTCGTGCTGCAAGTCCTCGGAGG - Exonic
1166813770 19:45529224-45529246 CTCGCCCCGCAGCGCCTCCCTGG + Exonic
1167591420 19:50406399-50406421 CTCCCGCAGCAGCACCTAGGTGG - Exonic
928252591 2:29694913-29694935 CTGGCGCCGCATCCCCTCCGAGG - Exonic
934503307 2:94874892-94874914 CTGGAGCCGCAGGTCCTCGGAGG - Exonic
947625305 2:231614876-231614898 CGCGCGCAGCAGCTCCCGGGCGG + Intergenic
948206647 2:236166245-236166267 CCCGCGGCGCCGCTGCTCGGCGG + Exonic
948560512 2:238848394-238848416 CTGGCTCTGCAGCTCCTCGAAGG - Exonic
948617684 2:239211887-239211909 CTCTCGAGGAAGCTCCTCGGTGG - Intronic
948910120 2:240998648-240998670 CTCTCGCCGCAGCTCCGCAGAGG - Intergenic
1171392363 20:24809726-24809748 CTCGCCCCACAGCTCCAGGGAGG - Intergenic
1172272771 20:33663815-33663837 TTTGCGCGGCTGCTCCTCGGCGG - Exonic
1176015040 20:62926557-62926579 CTAGCCCCGCAGCGTCTCGGTGG - Intronic
1176195021 20:63832720-63832742 CTCGCGCGGCACCCTCTCGGTGG + Intergenic
1176387108 21:6143612-6143634 CTGTCGCTGCAGCTCCTCGTGGG - Intergenic
1179563965 21:42234920-42234942 CCCGCGCCGCCGCTCCGCCGCGG - Intronic
1179627012 21:42654341-42654363 CTCGGGCCGCTGCACCTCCGGGG + Intronic
1179736365 21:43394640-43394662 CTGTCGCTGCAGCTCCTCGTGGG + Intergenic
1180034355 21:45236122-45236144 CTCCCACCCCAGCTCCTTGGTGG + Intergenic
1180801472 22:18634033-18634055 GACGCGCCGCAGCACCTCGCTGG - Intergenic
1180852708 22:19029573-19029595 GCCGCGCCGCAGCACCTCGCTGG - Intergenic
1181220249 22:21361228-21361250 GACGCGCCGCAGCACCTCGCTGG + Intergenic
1183223030 22:36529324-36529346 CTCGCGTCTCGGCGCCTCGGAGG - Exonic
1183369807 22:37426132-37426154 CTCCAGCCGCAGCTGCTGGGTGG + Intronic
950509882 3:13419843-13419865 CTCGCGCCTCAGCGGCGCGGAGG + Intronic
953024527 3:39137236-39137258 CTCACGCAGCAGTTTCTCGGCGG - Exonic
953881575 3:46693810-46693832 ACCGCGCGCCAGCTCCTCGGTGG - Intergenic
954140281 3:48601419-48601441 CTCGCCCAGAAGCACCTCGGTGG - Exonic
954215774 3:49123721-49123743 TCCGCACCGCAGCTCCTCTGTGG + Exonic
954437454 3:50503568-50503590 CACGGGCCGCAGCGCCTCTGCGG + Intronic
961402094 3:126654817-126654839 GTGGCGGCGCAGCTCCTCGCGGG + Intronic
967880619 3:194298803-194298825 CTCGCACTCCAGCTCCTCGGTGG + Intergenic
968516564 4:1018029-1018051 CTCACCCCGTAGCTCCTCGGGGG - Intronic
968659952 4:1794749-1794771 CACGCGCCGCGGTTCCTCGTGGG + Intronic
969203308 4:5622776-5622798 CAGGCGCCGCAGCTCGTCGGTGG + Exonic
969272550 4:6112764-6112786 CTTGGCCCGCAGCTCCTCGTTGG + Exonic
979335277 4:119455062-119455084 GTCGCGCCGAAGCTCCTCAATGG + Intergenic
985248084 4:187996654-187996676 CTCGCCCTGCAGCTCGCCGGTGG - Intronic
989379265 5:40797891-40797913 GCCGCGCCGCAGCCCCGCGGCGG + Intronic
999248363 5:150167207-150167229 CTCCTGGCGCAGCCCCTCGGGGG + Exonic
1007594056 6:43040602-43040624 CTGGCGCTGCAGCTCCTTAGAGG + Exonic
1007619995 6:43206129-43206151 CTGGCGCTGCAGCTCCTCAGAGG - Exonic
1013231490 6:108165321-108165343 CTCCCGCCGCTCGTCCTCGGCGG - Intronic
1015976465 6:138796090-138796112 CTCGGGCCGCAGCTCCGGAGAGG - Exonic
1026665573 7:72337293-72337315 CCTGCGCCCCAGCTCCTCCGAGG + Intronic
1029744008 7:102506766-102506788 CTCGCCCTGCACCTCCTCGTCGG + Exonic
1034329777 7:150272267-150272289 CCCGCCCCTCAGCTGCTCGGGGG - Intronic
1034668279 7:152837594-152837616 CCCGCCCCTCAGCTGCTCGGGGG + Intronic
1035331273 7:158098790-158098812 CTTTCTCCCCAGCTCCTCGGTGG - Intronic
1045215506 8:100145416-100145438 CGCCCGCCATAGCTCCTCGGGGG - Exonic
1055757733 9:79573103-79573125 CCCGCGCCGCGACTCCTCGAGGG + Intronic
1187669807 X:21657081-21657103 CACGCGCCGCAGTACGTCGGCGG + Exonic
1198312232 X:135434593-135434615 CTGGCGCCGCAGCCCCTCCTGGG - Intergenic
1199383652 X:147199335-147199357 CTCCTGCCTCAGCTCCTGGGTGG - Intergenic