ID: 1084044939

View in Genome Browser
Species Human (GRCh38)
Location 11:66563046-66563068
Sequence GCTCGCGCCGCAGCTCCTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044939_1084044947 16 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044939_1084044942 -8 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044939_1084044949 28 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044939_1084044950 29 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044939 Original CRISPR GCTCGCGCCGCAGCTCCTCG GGG (reversed) Exonic
900109377 1:999139-999161 GCTCGCGCCGCCGCTGCTGCCGG - Exonic
900156111 1:1203888-1203910 GCTCGCCCCGCTCTTCCTCGGGG + Exonic
900349595 1:2228307-2228329 GCCCGCGCCCCCGCTCCTCCCGG + Intergenic
900400442 1:2470845-2470867 GCTCCCTCTGCAGCTCCTCTGGG + Intronic
901325208 1:8361237-8361259 GCTCCCTCCTCAGCTCCTCCAGG - Exonic
902447826 1:16478328-16478350 GCTGGCGCCGCAGCTCCTCCTGG + Intergenic
902467726 1:16628541-16628563 GCTGGCGCTGCAGCTCCTCCTGG + Intergenic
902506855 1:16944187-16944209 GCTGGCGCCGCAGCTCCTCCTGG - Exonic
902508973 1:16955353-16955375 GCTCCCGCCGCAGCCCGTCACGG - Exonic
903322682 1:22552283-22552305 GCTCTCCCAGCAGCTCCTCCAGG - Intergenic
904237340 1:29123855-29123877 CCTGGCGCCGCAGCGCCGCGCGG + Intronic
904642059 1:31938374-31938396 GCTCCCGCCGCCGCCCCTCAGGG + Exonic
911052365 1:93681686-93681708 GCCCGCGCCGCGGCTGCTCCCGG + Intronic
915973628 1:160370917-160370939 GCCGGCGCCGGCGCTCCTCGCGG - Exonic
916212059 1:162367386-162367408 GCAGGCGCGGCAGCTCCTCCTGG - Exonic
916562068 1:165941722-165941744 GCCCACGGCCCAGCTCCTCGAGG + Intergenic
920878409 1:209858694-209858716 GCAGGGGCCGGAGCTCCTCGGGG + Intergenic
922729058 1:227940622-227940644 GCTCTGGCAGCAGCTCCTCCTGG + Intronic
1063407720 10:5813123-5813145 CCGCGGGTCGCAGCTCCTCGGGG - Intronic
1067851618 10:49758488-49758510 GCTGGCGCAGCAGGTCCTCCGGG - Exonic
1073289246 10:102405244-102405266 TCTCTCCCCGCAGCACCTCGGGG - Exonic
1073420695 10:103421524-103421546 GCACGCCCTGCAGCTCCTCCAGG - Exonic
1077495598 11:2885159-2885181 GCTGGCGCCGCGGCCCGTCGCGG - Exonic
1077495638 11:2885354-2885376 GCTCGCGGCTCAGCTCCTCGTGG + Exonic
1083780993 11:64917220-64917242 GCTCGCCCCGCCGCTTCTCTAGG + Exonic
1083940109 11:65891161-65891183 TCTCCCGCAGCAGCTCCTCCTGG - Exonic
1084044939 11:66563046-66563068 GCTCGCGCCGCAGCTCCTCGGGG - Exonic
1084082944 11:66840973-66840995 GCTCACTAGGCAGCTCCTCGTGG + Intronic
1092860832 12:12717684-12717706 GCTCGGGCCGTGGCTCGTCGGGG + Exonic
1095752748 12:45729496-45729518 GCTCGCCCCGCGGCTTCGCGCGG + Intergenic
1101303277 12:103503321-103503343 TCTGGCGCCCCAGCTCCTCCAGG + Intergenic
1103505928 12:121442407-121442429 GCTGGTGCCGCAGCTCCCGGGGG + Exonic
1107765601 13:43730857-43730879 GCTCAGGCCTCAGCTCCTCCAGG + Intronic
1113867569 13:113537323-113537345 GTTCTCCCCCCAGCTCCTCGAGG + Intronic
1114653130 14:24299410-24299432 TCTGGCGCGGCAGCCCCTCGGGG + Intronic
1121168851 14:91836429-91836451 CCTCGCGCGGCCGCGCCTCGAGG + Intronic
1122264175 14:100539024-100539046 GGTCTCGCCGCCGCTCCTCCGGG + Exonic
1122542735 14:102507127-102507149 GGTCGCCCAGCAGCTCCTGGCGG + Exonic
1122581959 14:102777051-102777073 GCTGGCGCCGCTCCTCCCCGCGG - Intergenic
1122971955 14:105155972-105155994 GCTCGATCAGCAGCTCCTCTTGG + Exonic
1124652341 15:31483320-31483342 GCCGCCGCCGCAGCTCCTCGCGG + Exonic
1125328941 15:38564314-38564336 GCTAGGGCCGAAGCTCTTCGCGG - Intronic
1125536296 15:40442319-40442341 GCCAGTGCCGCAGCTCCTCCCGG - Intronic
1125918639 15:43511087-43511109 CCTCGCACAGCAGCTCCGCGGGG - Intronic
1127480351 15:59372099-59372121 ACTCGCGCCGCAGCCGCTGGCGG - Intronic
1130564444 15:84981752-84981774 GGTCGTGCCGCAGCTCGGCGAGG + Intronic
1132848009 16:2009520-2009542 GCACCTGGCGCAGCTCCTCGCGG + Exonic
1134090723 16:11390392-11390414 GCTCCCGCCACACCTCCTCCAGG + Exonic
1134843042 16:17416608-17416630 GCAGGAGCCGCAGCTCCTCCAGG - Intronic
1136315804 16:29454208-29454230 GGTCCCGCTGCAGCTTCTCGCGG + Exonic
1136430381 16:30193550-30193572 GGTCCCGCTGCAGCTTCTCGCGG + Exonic
1136478414 16:30526850-30526872 GCTCGCGCCGCGGCCTCTCTAGG + Intronic
1136721088 16:32320159-32320181 GCTCAAGCAGCAGCTCCTCCAGG - Intergenic
1136839472 16:33526445-33526467 GCTCAAGCAGCAGCTCCTCCAGG - Intergenic
1138106506 16:54289696-54289718 GCGCGCGCCGCAGCGCCTGCAGG - Intergenic
1139778174 16:69330183-69330205 GCTGGCGCTGGAGCTCCCCGAGG - Exonic
1139779539 16:69339426-69339448 GCTCGCGCCACTGGGCCTCGGGG + Exonic
1142431573 16:90031322-90031344 GCTCGCGGTCCAGCTCCTCCCGG - Exonic
1203005344 16_KI270728v1_random:197611-197633 GCTCAAGCAGCAGCTCCTCCAGG + Intergenic
1203136894 16_KI270728v1_random:1733732-1733754 GCTCAAGCAGCAGCTCCTCCAGG + Intergenic
1203149636 16_KI270728v1_random:1826730-1826752 GCTCAAGCAGCAGCTCCTCCAGG - Intergenic
1142474378 17:180778-180800 GCCCGCGCCGGAGCTCCGGGAGG + Intronic
1143541767 17:7573412-7573434 CCTCACGCGGCCGCTCCTCGGGG - Intronic
1144958685 17:19032828-19032850 GCAGGAGCCGCAGCTCCCCGGGG + Intronic
1144976474 17:19141696-19141718 GCAGGAGCCGCAGCTCCCCGGGG - Intronic
1145991229 17:29080559-29080581 GTTCCCGCCGCAGCACCTCCCGG - Intronic
1146003954 17:29149128-29149150 CCTCGGGCCGGAGCTCCTGGGGG - Intronic
1147325958 17:39669744-39669766 GCCAGCGCCCCAGCTCCTGGCGG - Exonic
1147996612 17:44363289-44363311 GCTCAGGCAGCAGCGCCTCGCGG + Intronic
1151537931 17:74749164-74749186 GGGCGCGCAGCAGCTCCTCTCGG - Exonic
1152196465 17:78921297-78921319 GCTGGAGCTGGAGCTCCTCGGGG + Intronic
1153854972 18:9136762-9136784 GCTCGCGTCGCAGCCAATCGCGG + Exonic
1158787665 18:60735182-60735204 GCTCACACCTCAGCTCCTCCAGG - Intergenic
1160766957 19:812950-812972 GCACGCGCCGCACCACCCCGTGG - Exonic
1160795204 19:942187-942209 GCTCTGCCGGCAGCTCCTCGGGG - Intronic
1161973477 19:7596377-7596399 GCCCGCGGCCCAGCTCCGCGCGG + Intronic
1162341900 19:10096329-10096351 GCTCGCGTAACAGCTCCTCGTGG + Exonic
1162823315 19:13236392-13236414 GCTCGAGCCGCTGCTCCTCTTGG - Intronic
1163636251 19:18438342-18438364 GCTCGCTCCGCAGCCCCCAGGGG + Intergenic
1165792323 19:38499798-38499820 GCTCGCGCCGCCGGTCCCTGCGG - Exonic
1167074396 19:47239935-47239957 GCGCGCCCGGCAGCTCCCCGGGG - Intergenic
1168280482 19:55302832-55302854 GCTCGCGATGCAGCCTCTCGCGG - Exonic
1168689464 19:58368180-58368202 GCACGCGCCGGTGCTCCACGAGG + Exonic
927123451 2:19990303-19990325 GGTCGCGACCCAGCTCCTTGCGG - Intergenic
927714314 2:25342175-25342197 GCTCCCGCCGCGGCGCCCCGGGG - Intronic
927751398 2:25673539-25673561 GCTCGCGCCGCTTCTCCGCCCGG + Exonic
927896520 2:26786231-26786253 GCTCGGGCTGCGCCTCCTCGGGG - Exonic
929231666 2:39566585-39566607 GCTTTCTCCCCAGCTCCTCGTGG - Intergenic
930694791 2:54400610-54400632 GCTGGGCCCGCAGCTCCTCCAGG + Intergenic
935336815 2:102023923-102023945 GCCCGGGTCCCAGCTCCTCGGGG + Intronic
937986460 2:127640309-127640331 GCTCGGCCCACAGCTCTTCGGGG - Exonic
946921451 2:224585238-224585260 GCTGGCGCGGCGGCTCCGCGGGG + Exonic
947602819 2:231464897-231464919 ACTCACGCCGCGGCTCCTGGTGG + Intronic
1168771181 20:417887-417909 GCTCCCGCTGCAGCTCCTGAGGG - Exonic
1172447018 20:34998590-34998612 GCTGGCGCCGCAACTCTTCCAGG - Exonic
1176222302 20:63975420-63975442 GCTGGCCCCGCAGCGCCTCTTGG - Exonic
1176247008 20:64102222-64102244 GTTCCCGCCGCAGCGCCCCGGGG - Intergenic
1176387109 21:6143613-6143635 CCTGTCGCTGCAGCTCCTCGTGG - Intergenic
1179736364 21:43394639-43394661 CCTGTCGCTGCAGCTCCTCGTGG + Intergenic
1180784046 22:18537087-18537109 GCTCTCGCCCCAGCTCCCTGGGG + Intergenic
1181240947 22:21476439-21476461 GCTCTCGCCCCAGCTCCCTGGGG + Intergenic
1183374274 22:37453938-37453960 GCTATCGCCACAGCTCCTCTCGG + Intergenic
1184100808 22:42340993-42341015 GCGCGCCCCGCAGCTCCGCGGGG - Intronic
1184160164 22:42693030-42693052 GCAGCCGCGGCAGCTCCTCGGGG + Exonic
1184607094 22:45580422-45580444 GCTCGGGCCTCACCTCCTCCAGG - Intronic
953705112 3:45225397-45225419 GCTCGCCCTGCAGCTCCTCCAGG + Exonic
956987010 3:74712345-74712367 GCACGGGGCGGAGCTCCTCGGGG - Intergenic
961402093 3:126654816-126654838 GGTGGCGGCGCAGCTCCTCGCGG + Intronic
963827530 3:149971002-149971024 CCTCCCGCCGCAGCTCCTCGGGG - Exonic
968502624 4:958088-958110 GCACGCGCTCCAGCTCATCGCGG - Exonic
968516565 4:1018030-1018052 CCTCACCCCGTAGCTCCTCGGGG - Intronic
968659951 4:1794748-1794770 ACACGCGCCGCGGTTCCTCGTGG + Intronic
969161280 4:5261106-5261128 GCTCGCCCCCCAGCTGCTGGAGG - Intronic
972396710 4:38664272-38664294 GCTCGGGCCCCGGCTCCGCGCGG - Exonic
991488641 5:67163592-67163614 GCTCCCGCTGCACCTCCTCTTGG - Exonic
1001902704 5:175444686-175444708 GCGCGCGCCGCTGCGCCCCGAGG + Intergenic
1001933868 5:175691167-175691189 GCTTGCGCCGTTGCTCCGCGTGG - Intergenic
1002186017 5:177455190-177455212 GCTCGCGCAGTCGCTCCTCCTGG - Exonic
1005686652 6:28259424-28259446 GAAGGCGACGCAGCTCCTCGGGG + Exonic
1006860745 6:37170293-37170315 GCTCGTGCGGCAGCGCCGCGGGG - Exonic
1006860805 6:37170520-37170542 GCTCCTGCGGCAGCTCCTCTGGG + Exonic
1010198493 6:73263157-73263179 GCTCGCGCCGCGGCCGCGCGAGG + Exonic
1013225551 6:108117733-108117755 CCTCGCGCCTCAGCCTCTCGAGG - Intronic
1013366199 6:109440368-109440390 GCAGGCGCCGCGCCTCCTCGAGG - Intronic
1019536141 7:1530855-1530877 GGGCGCGCGGCGGCTCCTCGCGG - Exonic
1019715915 7:2539283-2539305 GCTGGCCCTGCAGCTCCTCCAGG - Exonic
1022469274 7:30672185-30672207 GCTCCAGCCCCAGCTCCTCCAGG + Intronic
1031447544 7:121873084-121873106 GTGCGCGCCGCGGCTCCTGGAGG - Exonic
1037788954 8:21919891-21919913 GCCCGCGCCGCCGCCACTCGGGG + Intronic
1039476653 8:37842394-37842416 GCTCGTTCCCCCGCTCCTCGGGG + Exonic
1042020572 8:64369405-64369427 GCCCGGCCCGCAGCTCCTCGCGG + Intergenic
1049654664 8:143792314-143792336 GCACGCGCAGCCGCTCCTGGTGG + Exonic
1049658963 8:143811261-143811283 TCTCGGGCGGCAGCGCCTCGAGG + Exonic
1049681168 8:143919011-143919033 GCTGGGCCCGCTGCTCCTCGGGG + Exonic
1050455772 9:5832845-5832867 GCTCGCGCCGCCGCTACCCCCGG + Exonic
1053050598 9:34958179-34958201 GCACACGCCGCAGCCCCCCGGGG + Intronic
1055757731 9:79573102-79573124 CCCCGCGCCGCGACTCCTCGAGG + Intronic
1061450524 9:130664785-130664807 GCTCGGGGAGCAGCTCTTCGAGG + Exonic
1061786402 9:133031053-133031075 GCTCCCGCCTCAGCTCCACGGGG - Exonic
1062425618 9:136504806-136504828 GCTTGCGCAGCTCCTCCTCGCGG + Exonic
1186426052 X:9465058-9465080 GCGCTCGCGGCAGCTCCCCGTGG + Exonic
1192546496 X:72018726-72018748 GCTGGCGCCGCCACTCCGCGGGG - Intergenic
1197215155 X:123860211-123860233 GCTCGGGCCGCGCCTCCTCCGGG + Exonic
1198312233 X:135434594-135434616 GCTGGCGCCGCAGCCCCTCCTGG - Intergenic
1200000217 X:153056316-153056338 GCTCTCGCCGCCGCCCCTGGGGG - Intergenic
1200059477 X:153477870-153477892 GCTGGAGCGGCAGCTCCTCAAGG + Intronic